Incidental Mutation 'R3978:Cybb'
ID311165
Institutional Source Beutler Lab
Gene Symbol Cybb
Ensembl Gene ENSMUSG00000015340
Gene Namecytochrome b-245, beta polypeptide
Synonymsgp91phox, gp91, Cgd, Nox2
MMRRC Submission 040941-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3978 (G1)
Quality Score222
Status Validated
ChromosomeX
Chromosomal Location9435252-9487771 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 9444588 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 425 (Y425C)
Ref Sequence ENSEMBL: ENSMUSP00000015484 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015484] [ENSMUST00000164685]
Predicted Effect probably damaging
Transcript: ENSMUST00000015484
AA Change: Y425C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000015484
Gene: ENSMUSG00000015340
AA Change: Y425C

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
Pfam:Ferric_reduct 54 220 8.4e-29 PFAM
Pfam:FAD_binding_6 292 395 1.6e-7 PFAM
Pfam:FAD_binding_8 292 395 1e-24 PFAM
Pfam:NAD_binding_6 401 551 5.7e-41 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154503
Predicted Effect probably benign
Transcript: ENSMUST00000164685
SMART Domains Protein: ENSMUSP00000128963
Gene: ENSMUSG00000015340

DomainStartEndE-ValueType
transmembrane domain 10 29 N/A INTRINSIC
transmembrane domain 50 72 N/A INTRINSIC
Meta Mutation Damage Score 0.5748 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: This gene encodes the heavy chain component of a heterodimeric transmembrane ion transporter composed of both a heavy and a light chain. This transporter mediates the transfer of electrons from nicotinamide adenine dinucleotide phosphate (NADPH) to oxygen to generate superoxide. This reaction is important in the innate immune response to pathogens. However, increased activity of the encoded protein also leads to the generation of reactive oxygen species that result in oxidative stress and can cause tissue damage. Conversely, loss of function of the related gene in human causes chronic granulomatous disease. Alternative splicing results in multiple transcript variants, although the full-length nature of some of these variants has not been determined. [provided by RefSeq, May 2013]
PHENOTYPE: Nullizygous mice show alterations in acute inflammation, synaptic plasticity, memory, metastatic potential, susceptibility to infection and induced GI injury, inflammatory response to chemical peritonitis, vascular response to Ang II, hypoxia-induced LV remodeling, and L-NAME-caused renal responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579F01Rik T C 3: 138,183,674 T61A probably benign Het
Adam28 A G 14: 68,610,994 V671A probably benign Het
Ankhd1 A T 18: 36,647,613 H1906L probably damaging Het
Ano5 G A 7: 51,587,806 V743I probably benign Het
Arfgef1 A G 1: 10,209,634 V236A probably benign Het
Arid2 A G 15: 96,363,622 D453G probably damaging Het
Atp2b1 C A 10: 98,996,933 probably null Het
Azin1 A T 15: 38,498,713 N135K probably damaging Het
B020004C17Rik G T 14: 57,017,188 M156I possibly damaging Het
Cfap54 T C 10: 92,962,412 T1662A probably benign Het
Cog8 T A 8: 107,053,037 I203F probably damaging Het
Col6a6 T C 9: 105,698,879 H2094R probably damaging Het
Dab2 A G 15: 6,435,163 probably null Het
Dpyd AAAT AAATGTATATAAAT 3: 118,897,088 probably benign Het
Dpyd AAT AATGTATATATAT 3: 118,897,089 probably benign Het
Eif3i T C 4: 129,592,336 E276G probably damaging Het
Fam171a1 A C 2: 3,225,035 M402L probably benign Het
Fga A T 3: 83,030,183 probably null Het
Foxp2 A G 6: 15,197,208 probably benign Het
Gbp2 C T 3: 142,629,986 T149I possibly damaging Het
Gm9631 A G 11: 121,943,568 Y281H possibly damaging Het
Gpr21 C T 2: 37,517,850 T136I probably benign Het
Gprc5b C T 7: 118,984,131 V172M probably damaging Het
Gprc6a C A 10: 51,621,101 V449L probably benign Het
Hdlbp T C 1: 93,421,351 I535V probably damaging Het
Helb A G 10: 120,089,625 V949A probably benign Het
Hoxc13 T C 15: 102,921,240 V18A possibly damaging Het
Hr A G 14: 70,563,584 T699A probably benign Het
Il27ra G A 8: 84,040,684 T170I probably benign Het
Insm2 T C 12: 55,600,838 Y456H probably benign Het
Katna1 T C 10: 7,752,754 M249T probably damaging Het
Lin9 T A 1: 180,668,792 I298N possibly damaging Het
Lyst G A 13: 13,634,168 R141Q possibly damaging Het
Nos3 T A 5: 24,377,931 D685E probably damaging Het
Oasl1 C T 5: 114,932,898 T274I probably damaging Het
Olfr485 A G 7: 108,159,612 M87T possibly damaging Het
Pdgfrb A T 18: 61,073,685 H661L probably damaging Het
Ppfia2 A G 10: 106,830,629 T399A possibly damaging Het
Ppp1ca T C 19: 4,192,254 I13T probably benign Het
Psmd1 T C 1: 86,128,187 M757T probably benign Het
Rdh19 A T 10: 127,850,075 R19W possibly damaging Het
Rfx7 A G 9: 72,615,111 T296A possibly damaging Het
Rgl2 G A 17: 33,935,162 R472H probably benign Het
Rhcg T C 7: 79,617,399 E43G probably benign Het
Rif1 T A 2: 52,116,747 probably null Het
Rorb A G 19: 18,937,890 V468A probably benign Het
Rxrb C T 17: 34,036,326 P209L possibly damaging Het
Sbf2 G T 7: 110,329,885 T1438K probably benign Het
Setd3 A T 12: 108,157,942 C163S possibly damaging Het
Slc15a1 C T 14: 121,489,827 D110N probably benign Het
Slc26a3 T A 12: 31,465,860 probably null Het
Slc5a5 A G 8: 70,889,395 V305A probably benign Het
Slc6a6 A T 6: 91,755,052 M621L probably benign Het
Smgc A T 15: 91,860,348 D301V probably damaging Het
Spata31d1c A G 13: 65,035,160 D172G possibly damaging Het
Syt15 T A 14: 34,223,104 C203S probably benign Het
Tdrd1 A G 19: 56,866,634 R1171G probably benign Het
Trp63 A G 16: 25,820,740 probably benign Het
Tspan9 A G 6: 127,967,247 V30A probably damaging Het
Ubp1 A T 9: 113,956,705 probably null Het
Vmn2r68 T A 7: 85,232,462 Y470F probably benign Het
Wbp1l T A 19: 46,653,957 probably null Het
Wee1 G T 7: 110,124,555 D226Y probably damaging Het
Yap1 C T 9: 8,004,284 G36D probably damaging Het
Zmym6 T C 4: 127,123,555 I951T possibly damaging Het
Other mutations in Cybb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01125:Cybb APN X 9446744 missense possibly damaging 0.46
IGL02145:Cybb APN X 9457018 missense probably damaging 1.00
IGL02626:Cybb APN X 9469200 splice site probably null
IGL02644:Cybb APN X 9467156 missense probably benign 0.00
IGL02869:Cybb APN X 9442589 missense probably benign 0.00
IGL03145:Cybb APN X 9453653 nonsense probably null
R3980:Cybb UTSW X 9444588 missense probably damaging 1.00
R4758:Cybb UTSW X 9450750 missense probably benign 0.10
R4761:Cybb UTSW X 9450750 missense probably benign 0.10
R4787:Cybb UTSW X 9450750 missense probably benign 0.10
R4788:Cybb UTSW X 9450750 missense probably benign 0.10
R4793:Cybb UTSW X 9450750 missense probably benign 0.10
R4847:Cybb UTSW X 9450750 missense probably benign 0.10
R4901:Cybb UTSW X 9450750 missense probably benign 0.10
R4902:Cybb UTSW X 9450750 missense probably benign 0.10
R4904:Cybb UTSW X 9450750 missense probably benign 0.10
R4914:Cybb UTSW X 9450750 missense probably benign 0.10
R4915:Cybb UTSW X 9450750 missense probably benign 0.10
R4916:Cybb UTSW X 9450750 missense probably benign 0.10
R5058:Cybb UTSW X 9450750 missense probably benign 0.10
R5246:Cybb UTSW X 9450750 missense probably benign 0.10
R5416:Cybb UTSW X 9450750 missense probably benign 0.10
R5519:Cybb UTSW X 9450750 missense probably benign 0.10
R5538:Cybb UTSW X 9450750 missense probably benign 0.10
R5539:Cybb UTSW X 9450750 missense probably benign 0.10
R5576:Cybb UTSW X 9450750 missense probably benign 0.10
R5578:Cybb UTSW X 9450750 missense probably benign 0.10
R5728:Cybb UTSW X 9450750 missense probably benign 0.10
R5729:Cybb UTSW X 9450750 missense probably benign 0.10
R5761:Cybb UTSW X 9450750 missense probably benign 0.10
R5762:Cybb UTSW X 9450750 missense probably benign 0.10
R5927:Cybb UTSW X 9450750 missense probably benign 0.10
R6057:Cybb UTSW X 9450750 missense probably benign 0.10
R6086:Cybb UTSW X 9450750 missense probably benign 0.10
R6144:Cybb UTSW X 9450750 missense probably benign 0.10
R6147:Cybb UTSW X 9450750 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- TCTACTCTCTTGAAGCAAGCC -3'
(R):5'- ATGGGGATTTCCTATGCATAGAGTC -3'

Sequencing Primer
(F):5'- AAGCCTGCCTCTCTGGAGTC -3'
(R):5'- CCTATGCATAGAGTCAGCATAGTGC -3'
Posted On2015-04-29