Incidental Mutation 'R0383:Nalcn'
ID31119
Institutional Source Beutler Lab
Gene Symbol Nalcn
Ensembl Gene ENSMUSG00000000197
Gene Namesodium leak channel, non-selective
SynonymsA530023G15Rik, Vgcnl1
MMRRC Submission 038589-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0383 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location123276634-123627144 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 123507559 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 352 (H352Q)
Ref Sequence ENSEMBL: ENSMUSP00000000201 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000201]
Predicted Effect probably benign
Transcript: ENSMUST00000000201
AA Change: H352Q

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000000201
Gene: ENSMUSG00000000197
AA Change: H352Q

DomainStartEndE-ValueType
Pfam:Ion_trans 35 333 2.8e-37 PFAM
low complexity region 338 348 N/A INTRINSIC
Pfam:Ion_trans 383 609 5.7e-34 PFAM
coiled coil region 796 830 N/A INTRINSIC
Pfam:Ion_trans 885 1166 2.4e-42 PFAM
Pfam:Ion_trans 1209 1458 6.9e-30 PFAM
low complexity region 1548 1560 N/A INTRINSIC
low complexity region 1634 1649 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226617
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227818
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228860
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 88.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NALCN forms a voltage-independent, nonselective, noninactivating cation channel permeable to Na+, K+, and Ca(2+). It is responsible for the neuronal background sodium leak conductance (Lu et al., 2007 [PubMed 17448995]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit abnormal breathing at birth and die within 24 hours. Mice homozygous for a gain of function ENU mutation exhibit reduced the total amount and episode duration of REMS. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik A G 7: 131,239,539 M537V probably benign Het
5730455P16Rik G T 11: 80,363,941 Y351* probably null Het
A530099J19Rik A G 13: 19,729,147 noncoding transcript Het
Aadac G T 3: 60,035,947 R91L possibly damaging Het
Adgrg1 T A 8: 95,011,742 F621Y probably damaging Het
Ankmy1 G T 1: 92,885,053 D511E probably benign Het
Anks4b A T 7: 120,182,874 D376V probably damaging Het
Aox1 G T 1: 58,061,241 C399F probably benign Het
Arfgef1 C T 1: 10,198,842 probably null Het
Arhgef4 G A 1: 34,810,533 V546M probably damaging Het
Cab39 T A 1: 85,837,299 V98E probably damaging Het
Cacna1b T C 2: 24,761,844 N108D probably damaging Het
Car15 C A 16: 17,836,753 E134* probably null Het
Ccdc80 T G 16: 45,095,369 Y163D probably damaging Het
Col22a1 C T 15: 71,869,004 G513D unknown Het
Col8a1 T C 16: 57,632,442 D66G probably damaging Het
Crot C A 5: 8,968,734 S544I probably damaging Het
Cubn G T 2: 13,430,959 P1062Q probably damaging Het
Dcc A T 18: 71,420,263 V774E probably damaging Het
Dlgap5 T A 14: 47,410,361 M240L probably benign Het
Dlx4 A G 11: 95,145,435 V16A probably benign Het
Dnah17 G T 11: 118,067,547 H2703Q probably benign Het
Duox2 A G 2: 122,291,810 probably null Het
Fn1 C T 1: 71,597,685 V168I probably damaging Het
Fpr-rs4 A T 17: 18,022,097 D122V probably damaging Het
Gas2l2 A T 11: 83,423,097 I463N probably benign Het
Ggta1 G T 2: 35,402,404 P297Q probably damaging Het
Gpatch3 C A 4: 133,578,146 R231S probably damaging Het
Gpc1 T C 1: 92,854,983 Y151H probably damaging Het
Gtf2e2 T C 8: 33,755,945 W119R probably damaging Het
H2-M10.2 T C 17: 36,284,361 I304V probably benign Het
Helq T C 5: 100,779,165 K685R probably benign Het
Hps5 C T 7: 46,769,288 probably null Het
Iars T C 13: 49,732,342 C1186R probably damaging Het
Ift43 T C 12: 86,162,021 V158A possibly damaging Het
Iqca A T 1: 90,142,707 I141N probably damaging Het
Kat6b A G 14: 21,669,081 N1276S probably benign Het
Kif19a A T 11: 114,765,514 M1L possibly damaging Het
Kif1b T G 4: 149,202,512 H1241P probably damaging Het
Kif26a T C 12: 112,178,076 V1588A possibly damaging Het
Klb T A 5: 65,372,499 probably null Het
Krtap26-1 A T 16: 88,647,243 Y163* probably null Het
Lefty1 G T 1: 180,937,634 E256* probably null Het
Lox T C 18: 52,529,199 N44S possibly damaging Het
Marf1 C T 16: 14,142,534 A549T probably damaging Het
Mctp1 A G 13: 76,801,544 Y565C probably damaging Het
Megf6 C T 4: 154,265,326 A961V probably benign Het
Mindy4 A G 6: 55,276,634 K496R probably benign Het
Ncoa5 T C 2: 165,009,390 I188V possibly damaging Het
Notum G T 11: 120,654,456 H426N probably benign Het
Olfr569 T A 7: 102,887,251 I301F possibly damaging Het
Orm2 A T 4: 63,363,996 D137V probably damaging Het
Pabpc2 G A 18: 39,775,395 G571D probably damaging Het
Pabpc4 A G 4: 123,297,942 N599S probably damaging Het
Pak1ip1 T C 13: 41,012,604 V335A probably benign Het
Pcdhb11 A C 18: 37,423,393 D592A probably damaging Het
Pmch C A 10: 88,091,258 T41K possibly damaging Het
Polb G T 8: 22,639,995 S187* probably null Het
Pter G T 2: 13,000,942 G309* probably null Het
Ptprg T C 14: 12,219,024 V406A possibly damaging Het
Ranbp3l A T 15: 9,063,104 E467V possibly damaging Het
Rif1 T A 2: 52,085,141 M354K probably damaging Het
Ripk4 C T 16: 97,748,112 C248Y probably damaging Het
Slc6a15 T C 10: 103,418,053 W617R probably damaging Het
Smyd5 C T 6: 85,440,173 Q178* probably null Het
St18 T A 1: 6,803,024 F328I probably damaging Het
Supt20 T A 3: 54,703,149 L124* probably null Het
Tarbp1 T A 8: 126,447,484 H861L probably benign Het
Tars A G 15: 11,390,325 M356T probably benign Het
Tbc1d10a A G 11: 4,212,819 T221A probably damaging Het
Tead3 A G 17: 28,334,698 probably null Het
Tprg A G 16: 25,422,235 T254A probably damaging Het
Trank1 C A 9: 111,391,477 N2427K probably benign Het
Ttc30b A G 2: 75,938,242 Y56H probably damaging Het
Tufm T C 7: 126,489,864 S380P probably damaging Het
Tyrobp C T 7: 30,414,617 R68C probably damaging Het
Ubl4b T C 3: 107,554,827 E39G possibly damaging Het
Uggt2 A T 14: 119,049,451 F661I probably damaging Het
Upf3b A G X: 37,104,467 I144T probably benign Het
Usp54 A T 14: 20,561,252 D1165E probably benign Het
Vmn2r81 C T 10: 79,293,447 T724I possibly damaging Het
Vsig1 A G X: 140,936,313 I247M possibly damaging Het
Zfp110 C A 7: 12,849,260 L612I probably benign Het
Zfp318 C A 17: 46,413,296 T2075K probably damaging Het
Zfp37 A G 4: 62,191,885 M1T probably null Het
Zfp605 T A 5: 110,128,854 C613S probably damaging Het
Zfp729a G A 13: 67,621,673 P146S possibly damaging Het
Zfp85 T C 13: 67,748,672 N427S probably benign Het
Other mutations in Nalcn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Nalcn APN 14 123348789 missense probably benign 0.00
IGL00964:Nalcn APN 14 123295384 splice site probably benign
IGL01310:Nalcn APN 14 123317249 missense probably benign 0.00
IGL01578:Nalcn APN 14 123572091 missense probably benign 0.00
IGL01925:Nalcn APN 14 123291848 missense possibly damaging 0.88
IGL02072:Nalcn APN 14 123323358 missense probably benign 0.05
IGL02096:Nalcn APN 14 123594503 missense probably benign 0.11
IGL02212:Nalcn APN 14 123515330 missense probably damaging 0.99
IGL02306:Nalcn APN 14 123323338 missense probably benign 0.07
IGL02471:Nalcn APN 14 123323314 missense probably benign 0.02
IGL02478:Nalcn APN 14 123321305 missense probably benign 0.26
IGL02551:Nalcn APN 14 123323338 missense probably benign 0.07
IGL02630:Nalcn APN 14 123317879 missense probably benign 0.16
IGL02632:Nalcn APN 14 123317853 missense probably benign 0.11
IGL02661:Nalcn APN 14 123592909 splice site probably benign
IGL02830:Nalcn APN 14 123293469 missense probably damaging 0.98
IGL02939:Nalcn APN 14 123298872 missense probably null 1.00
IGL03035:Nalcn APN 14 123278218 nonsense probably null
IGL03226:Nalcn APN 14 123281115 missense probably benign 0.00
IGL03242:Nalcn APN 14 123321487 missense possibly damaging 0.91
Narnia UTSW 14 123291047 missense probably benign 0.11
R0019:Nalcn UTSW 14 123507489 missense probably benign 0.18
R0144:Nalcn UTSW 14 123371536 missense probably damaging 0.96
R0144:Nalcn UTSW 14 123409839 splice site probably benign
R0359:Nalcn UTSW 14 123299168 missense probably damaging 1.00
R0400:Nalcn UTSW 14 123290960 splice site probably benign
R0467:Nalcn UTSW 14 123291047 missense probably benign 0.11
R0506:Nalcn UTSW 14 123596614 missense possibly damaging 0.82
R0583:Nalcn UTSW 14 123294343 missense possibly damaging 0.46
R0620:Nalcn UTSW 14 123299141 splice site probably benign
R0624:Nalcn UTSW 14 123370032 missense probably benign
R0883:Nalcn UTSW 14 123464740 missense probably damaging 1.00
R1381:Nalcn UTSW 14 123314105 missense probably damaging 1.00
R1467:Nalcn UTSW 14 123464656 splice site probably benign
R1689:Nalcn UTSW 14 123285254 missense probably damaging 1.00
R1726:Nalcn UTSW 14 123308404 missense probably damaging 1.00
R1774:Nalcn UTSW 14 123278266 missense probably benign
R1854:Nalcn UTSW 14 123460412 missense probably damaging 1.00
R1869:Nalcn UTSW 14 123594553 missense possibly damaging 0.96
R1871:Nalcn UTSW 14 123594553 missense possibly damaging 0.96
R1873:Nalcn UTSW 14 123283601 missense probably benign 0.00
R1899:Nalcn UTSW 14 123316126 missense possibly damaging 0.50
R1915:Nalcn UTSW 14 123302769 missense probably benign 0.08
R2016:Nalcn UTSW 14 123594581 splice site probably null
R2034:Nalcn UTSW 14 123283603 missense probably benign 0.01
R2087:Nalcn UTSW 14 123281145 missense probably benign
R2149:Nalcn UTSW 14 123370017 missense probably benign 0.01
R2157:Nalcn UTSW 14 123409752 missense probably benign 0.32
R2166:Nalcn UTSW 14 123369951 missense probably benign 0.00
R2932:Nalcn UTSW 14 123593018 missense probably benign 0.06
R3408:Nalcn UTSW 14 123596617 missense probably null 0.98
R3778:Nalcn UTSW 14 123464716 missense probably damaging 1.00
R3807:Nalcn UTSW 14 123278187 missense probably damaging 1.00
R3835:Nalcn UTSW 14 123293422 splice site probably benign
R3937:Nalcn UTSW 14 123369945 missense probably benign 0.00
R4001:Nalcn UTSW 14 123596594 missense probably damaging 1.00
R4015:Nalcn UTSW 14 123486387 missense probably damaging 1.00
R4033:Nalcn UTSW 14 123599989 splice site probably benign
R4231:Nalcn UTSW 14 123599913 missense probably benign 0.01
R4464:Nalcn UTSW 14 123323350 missense probably benign
R4512:Nalcn UTSW 14 123295448 missense probably damaging 1.00
R4542:Nalcn UTSW 14 123321477 synonymous silent
R4557:Nalcn UTSW 14 123321235 intron probably benign
R4869:Nalcn UTSW 14 123599884 missense probably benign 0.44
R5083:Nalcn UTSW 14 123323294 splice site probably null
R5109:Nalcn UTSW 14 123278238 missense possibly damaging 0.86
R5131:Nalcn UTSW 14 123515770 missense probably damaging 0.98
R5158:Nalcn UTSW 14 123515737 missense probably damaging 1.00
R5259:Nalcn UTSW 14 123515651 missense possibly damaging 0.94
R5422:Nalcn UTSW 14 123515365 missense probably damaging 1.00
R5514:Nalcn UTSW 14 123283711 missense probably benign 0.14
R5523:Nalcn UTSW 14 123409743 missense probably damaging 1.00
R5551:Nalcn UTSW 14 123278286 missense possibly damaging 0.57
R5667:Nalcn UTSW 14 123295406 missense probably damaging 1.00
R5671:Nalcn UTSW 14 123295406 missense probably damaging 1.00
R5750:Nalcn UTSW 14 123572038 missense probably benign
R5765:Nalcn UTSW 14 123464726 missense possibly damaging 0.46
R6324:Nalcn UTSW 14 123409749 missense possibly damaging 0.83
R6523:Nalcn UTSW 14 123317843 missense probably benign 0.00
R6558:Nalcn UTSW 14 123486507 missense probably benign
R6631:Nalcn UTSW 14 123460251 missense probably benign 0.17
R6667:Nalcn UTSW 14 123321323 missense probably damaging 1.00
R6670:Nalcn UTSW 14 123464672 missense possibly damaging 0.96
R6724:Nalcn UTSW 14 123298067 missense probably damaging 0.99
R6731:Nalcn UTSW 14 123599934 missense probably benign 0.22
R6957:Nalcn UTSW 14 123507554 missense probably damaging 0.96
R6970:Nalcn UTSW 14 123314094 missense possibly damaging 0.46
R7010:Nalcn UTSW 14 123293465 missense probably damaging 1.00
R7018:Nalcn UTSW 14 123409821 missense probably damaging 1.00
R7040:Nalcn UTSW 14 123287855 missense probably benign
R7089:Nalcn UTSW 14 123278349 missense probably benign 0.01
R7128:Nalcn UTSW 14 123594502 missense probably damaging 0.99
R7149:Nalcn UTSW 14 123599865 missense probably benign 0.02
X0060:Nalcn UTSW 14 123285241 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCAAGTTTAGAGCTTGGAGCCTATG -3'
(R):5'- CCCCATGTTGAAGGTGAATCCCTG -3'

Sequencing Primer
(F):5'- AGAGCTTGGAGCCTATGAATTTC -3'
(R):5'- GGTGAATCCCTGATATTATTTGACG -3'
Posted On2013-04-24