Incidental Mutation 'R4002:Grcc10'
ID311306
Institutional Source Beutler Lab
Gene Symbol Grcc10
Ensembl Gene ENSMUSG00000072772
Gene Namegene rich cluster, C10 gene
Synonyms
MMRRC Submission 041609-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.303) question?
Stock #R4002 (G1)
Quality Score155
Status Validated
Chromosome6
Chromosomal Location124739183-124741374 bp(-) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) A to T at 124740970 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 1 (M1K)
Ref Sequence ENSEMBL: ENSMUSP00000004389 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004377] [ENSMUST00000004389] [ENSMUST00000088357] [ENSMUST00000129411] [ENSMUST00000171549] [ENSMUST00000174265]
Predicted Effect probably benign
Transcript: ENSMUST00000004377
SMART Domains Protein: ENSMUSP00000004377
Gene: ENSMUSG00000004266

DomainStartEndE-ValueType
SH2 4 87 1.43e-28 SMART
SH2 110 202 1.45e-29 SMART
PTPc 245 519 7.51e-131 SMART
low complexity region 571 581 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000004389
AA Change: M1K
SMART Domains Protein: ENSMUSP00000004389
Gene: ENSMUSG00000072772
AA Change: M1K

DomainStartEndE-ValueType
Pfam:DUF4511 11 113 5e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000088357
SMART Domains Protein: ENSMUSP00000085695
Gene: ENSMUSG00000004263

DomainStartEndE-ValueType
Pfam:Atrophin-1 1 191 7.9e-30 PFAM
low complexity region 209 218 N/A INTRINSIC
low complexity region 231 253 N/A INTRINSIC
low complexity region 256 297 N/A INTRINSIC
low complexity region 301 317 N/A INTRINSIC
low complexity region 351 372 N/A INTRINSIC
low complexity region 378 396 N/A INTRINSIC
Pfam:Atrophin-1 405 1174 4.6e-209 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129411
SMART Domains Protein: ENSMUSP00000115407
Gene: ENSMUSG00000107478

DomainStartEndE-ValueType
Pfam:Atrophin-1 1 164 3.8e-33 PFAM
low complexity region 209 218 N/A INTRINSIC
low complexity region 231 253 N/A INTRINSIC
low complexity region 256 297 N/A INTRINSIC
low complexity region 301 317 N/A INTRINSIC
Pfam:Atrophin-1 327 1175 1.7e-192 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129823
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133577
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137318
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140423
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158458
Predicted Effect probably benign
Transcript: ENSMUST00000171549
SMART Domains Protein: ENSMUSP00000129124
Gene: ENSMUSG00000004266

DomainStartEndE-ValueType
SH2 4 87 1.43e-28 SMART
SH2 110 202 1.45e-29 SMART
PTPc 245 519 7.51e-131 SMART
low complexity region 571 581 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174265
SMART Domains Protein: ENSMUSP00000133991
Gene: ENSMUSG00000004266

DomainStartEndE-ValueType
Pfam:SH2 1 40 3.5e-6 PFAM
SH2 69 161 1.45e-29 SMART
PTPc 204 478 7.51e-131 SMART
low complexity region 530 540 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174861
Meta Mutation Damage Score 0.402 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 97% (29/30)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is ubiquitously expressed in human tissues. It is required for development of the human corpus callosum. Mutations in this gene are associated with Temtamy syndrome (TEMTYS). Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2014]
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik T A 7: 41,625,540 N222K possibly damaging Het
Abca13 A T 11: 9,585,415 M4680L probably benign Het
Adgrv1 GA GAA 13: 81,540,132 probably null Het
Afdn T C 17: 13,883,917 S1157P probably damaging Het
Ank1 A G 8: 23,139,463 T63A probably damaging Het
Asah1 A G 8: 41,348,139 probably benign Het
Cdh18 T A 15: 23,382,962 L277I possibly damaging Het
Ces3a A T 8: 105,057,461 D431V probably damaging Het
Dbx1 T C 7: 49,636,517 S67G probably benign Het
Dmxl2 A G 9: 54,473,832 probably benign Het
Dnah7a T A 1: 53,631,681 T471S probably benign Het
Efcab8 A T 2: 153,781,806 K70N probably benign Het
Gm5434 G A 12: 36,090,636 probably benign Het
Higd2a G C 13: 54,590,727 C53S probably damaging Het
Kcna4 C T 2: 107,295,914 P331L probably damaging Het
Keg1 T A 19: 12,718,943 S164T possibly damaging Het
Ltbp1 T C 17: 75,310,159 V1031A probably benign Het
Obsl1 G A 1: 75,500,099 T737I possibly damaging Het
Olfr129 G A 17: 38,054,988 L193F probably damaging Het
Olfr853 C T 9: 19,537,906 R8K probably benign Het
Olfr855 T G 9: 19,584,714 M59R probably damaging Het
Serpinb6d A G 13: 33,670,647 M202V probably damaging Het
Tcf19 A G 17: 35,515,925 probably null Het
Tlr11 T C 14: 50,362,527 F657L probably benign Het
Ttf2 G A 3: 100,948,225 Q96* probably null Het
Zbbx C T 3: 75,105,671 G151E probably damaging Het
Zfp810 C T 9: 22,278,892 C240Y probably damaging Het
Other mutations in Grcc10
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1717:Grcc10 UTSW 6 124740513 unclassified probably benign
R1855:Grcc10 UTSW 6 124740578 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- ATAAGCTTGTCCTCCCAACC -3'
(R):5'- AGCAAAACAGTTCTCTTCCCCG -3'

Sequencing Primer
(F):5'- CAACCCTTCGCCCTAATGG -3'
(R):5'- AGAGGGGCTTTGATCCTTCTC -3'
Posted On2015-04-29