Incidental Mutation 'R4002:Dbx1'
ID311308
Institutional Source Beutler Lab
Gene Symbol Dbx1
Ensembl Gene ENSMUSG00000030507
Gene Namedeveloping brain homeobox 1
SynonymsDbx, Mmox C
MMRRC Submission 041609-MU
Accession Numbers

Genbank: NM_001005232; MGI: 94867

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4002 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location49631499-49636849 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 49636517 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 67 (S67G)
Ref Sequence ENSEMBL: ENSMUSP00000032717 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032717]
Predicted Effect probably benign
Transcript: ENSMUST00000032717
AA Change: S67G

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000032717
Gene: ENSMUSG00000030507
AA Change: S67G

DomainStartEndE-ValueType
low complexity region 14 31 N/A INTRINSIC
low complexity region 83 95 N/A INTRINSIC
HOX 181 243 1.45e-23 SMART
low complexity region 299 331 N/A INTRINSIC
Meta Mutation Damage Score 0.1164 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 97% (29/30)
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions of this gene die at birth. V0 interneurons develop as V1 or dl6 interneurons. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, other(6)

Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik T A 7: 41,625,540 N222K possibly damaging Het
Abca13 A T 11: 9,585,415 M4680L probably benign Het
Adgrv1 GA GAA 13: 81,540,132 probably null Het
Afdn T C 17: 13,883,917 S1157P probably damaging Het
Ank1 A G 8: 23,139,463 T63A probably damaging Het
Asah1 A G 8: 41,348,139 probably benign Het
Cdh18 T A 15: 23,382,962 L277I possibly damaging Het
Ces3a A T 8: 105,057,461 D431V probably damaging Het
Dmxl2 A G 9: 54,473,832 probably benign Het
Dnah7a T A 1: 53,631,681 T471S probably benign Het
Efcab8 A T 2: 153,781,806 K70N probably benign Het
Gm5434 G A 12: 36,090,636 probably benign Het
Grcc10 A T 6: 124,740,970 M1K probably null Het
Higd2a G C 13: 54,590,727 C53S probably damaging Het
Kcna4 C T 2: 107,295,914 P331L probably damaging Het
Keg1 T A 19: 12,718,943 S164T possibly damaging Het
Ltbp1 T C 17: 75,310,159 V1031A probably benign Het
Obsl1 G A 1: 75,500,099 T737I possibly damaging Het
Olfr129 G A 17: 38,054,988 L193F probably damaging Het
Olfr853 C T 9: 19,537,906 R8K probably benign Het
Olfr855 T G 9: 19,584,714 M59R probably damaging Het
Serpinb6d A G 13: 33,670,647 M202V probably damaging Het
Tcf19 A G 17: 35,515,925 probably null Het
Tlr11 T C 14: 50,362,527 F657L probably benign Het
Ttf2 G A 3: 100,948,225 Q96* probably null Het
Zbbx C T 3: 75,105,671 G151E probably damaging Het
Zfp810 C T 9: 22,278,892 C240Y probably damaging Het
Other mutations in Dbx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00498:Dbx1 APN 7 49636474 missense probably benign 0.22
IGL02795:Dbx1 APN 7 49636577 missense probably benign 0.03
R0630:Dbx1 UTSW 7 49632696 missense probably damaging 1.00
R3104:Dbx1 UTSW 7 49636669 missense probably damaging 1.00
R3147:Dbx1 UTSW 7 49636549 missense probably damaging 1.00
R5035:Dbx1 UTSW 7 49632536 missense unknown
R5077:Dbx1 UTSW 7 49633494 missense probably damaging 1.00
R5689:Dbx1 UTSW 7 49632771 missense probably damaging 1.00
X0066:Dbx1 UTSW 7 49632491 missense unknown
Predicted Primers PCR Primer
(F):5'- AGGGCACGGCTGTATCTTAC -3'
(R):5'- ACCCGCTCTAACCATGATGTTC -3'

Sequencing Primer
(F):5'- GCACGGCTGTATCTTACCTCTTCTAG -3'
(R):5'- AACCATGATGTTCCCCGGC -3'
Posted On2015-04-29