Incidental Mutation 'R4002:Olfr853'
ID311311
Institutional Source Beutler Lab
Gene Symbol Olfr853
Ensembl Gene ENSMUSG00000051160
Gene Nameolfactory receptor 853
SynonymsMOR154-1, GA_x6K02T2PVTD-13277703-13276786
MMRRC Submission 041609-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.047) question?
Stock #R4002 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location19534202-19541076 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 19537906 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Lysine at position 8 (R8K)
Ref Sequence ENSEMBL: ENSMUSP00000150773 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058296] [ENSMUST00000213834]
Predicted Effect probably benign
Transcript: ENSMUST00000058296
AA Change: R8K

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000053262
Gene: ENSMUSG00000051160
AA Change: R8K

DomainStartEndE-ValueType
Pfam:7tm_4 31 305 1.3e-57 PFAM
Pfam:7TM_GPCR_Srsx 35 206 1.7e-7 PFAM
Pfam:7tm_1 41 290 1.1e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212273
Predicted Effect probably benign
Transcript: ENSMUST00000213834
AA Change: R8K

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Meta Mutation Damage Score 0.0892 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 97% (29/30)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik T A 7: 41,625,540 N222K possibly damaging Het
Abca13 A T 11: 9,585,415 M4680L probably benign Het
Adgrv1 GA GAA 13: 81,540,132 probably null Het
Afdn T C 17: 13,883,917 S1157P probably damaging Het
Ank1 A G 8: 23,139,463 T63A probably damaging Het
Asah1 A G 8: 41,348,139 probably benign Het
Cdh18 T A 15: 23,382,962 L277I possibly damaging Het
Ces3a A T 8: 105,057,461 D431V probably damaging Het
Dbx1 T C 7: 49,636,517 S67G probably benign Het
Dmxl2 A G 9: 54,473,832 probably benign Het
Dnah7a T A 1: 53,631,681 T471S probably benign Het
Efcab8 A T 2: 153,781,806 K70N probably benign Het
Gm5434 G A 12: 36,090,636 probably benign Het
Grcc10 A T 6: 124,740,970 M1K probably null Het
Higd2a G C 13: 54,590,727 C53S probably damaging Het
Kcna4 C T 2: 107,295,914 P331L probably damaging Het
Keg1 T A 19: 12,718,943 S164T possibly damaging Het
Ltbp1 T C 17: 75,310,159 V1031A probably benign Het
Obsl1 G A 1: 75,500,099 T737I possibly damaging Het
Olfr129 G A 17: 38,054,988 L193F probably damaging Het
Olfr855 T G 9: 19,584,714 M59R probably damaging Het
Serpinb6d A G 13: 33,670,647 M202V probably damaging Het
Tcf19 A G 17: 35,515,925 probably null Het
Tlr11 T C 14: 50,362,527 F657L probably benign Het
Ttf2 G A 3: 100,948,225 Q96* probably null Het
Zbbx C T 3: 75,105,671 G151E probably damaging Het
Zfp810 C T 9: 22,278,892 C240Y probably damaging Het
Other mutations in Olfr853
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02074:Olfr853 APN 9 19537852 missense possibly damaging 0.94
IGL02078:Olfr853 APN 9 19537453 missense probably benign 0.14
IGL02092:Olfr853 APN 9 19537750 missense probably damaging 0.99
IGL02728:Olfr853 APN 9 19537846 missense possibly damaging 0.95
R0245:Olfr853 UTSW 9 19537112 missense probably benign 0.01
R1331:Olfr853 UTSW 9 19537546 missense probably benign 0.03
R1661:Olfr853 UTSW 9 19537328 missense probably benign 0.00
R1696:Olfr853 UTSW 9 19537894 missense probably damaging 1.00
R2004:Olfr853 UTSW 9 19537392 nonsense probably null
R2182:Olfr853 UTSW 9 19537342 missense probably benign 0.24
R3730:Olfr853 UTSW 9 19537151 missense probably benign 0.01
R4627:Olfr853 UTSW 9 19537673 missense possibly damaging 0.86
R5027:Olfr853 UTSW 9 19537277 missense probably damaging 1.00
R5486:Olfr853 UTSW 9 19537294 missense probably benign
R5931:Olfr853 UTSW 9 19537333 missense probably benign 0.38
R6229:Olfr853 UTSW 9 19537718 missense possibly damaging 0.91
R6564:Olfr853 UTSW 9 19537210 missense possibly damaging 0.95
R6718:Olfr853 UTSW 9 19537199 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACAGTGGTGGTGCTGAAGC -3'
(R):5'- TTTACAAACTGGACACTGAAGC -3'

Sequencing Primer
(F):5'- CAGATATCAGTGAAGGACAGGTTTG -3'
(R):5'- CTGGACACTGAAGCCAGATTTAG -3'
Posted On2015-04-29