Incidental Mutation 'R4002:Serpinb6d'
ID311318
Institutional Source Beutler Lab
Gene Symbol Serpinb6d
Ensembl Gene ENSMUSG00000047889
Gene Nameserine (or cysteine) peptidase inhibitor, clade B, member 6d
SynonymsSPI3D, Gm11390
MMRRC Submission 041609-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.135) question?
Stock #R4002 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location33661405-33671581 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 33670647 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 202 (M202V)
Ref Sequence ENSEMBL: ENSMUSP00000152621 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059637] [ENSMUST00000221681]
Predicted Effect probably damaging
Transcript: ENSMUST00000059637
AA Change: M202V

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000063025
Gene: ENSMUSG00000047889
AA Change: M202V

DomainStartEndE-ValueType
SERPIN 13 375 1.67e-144 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000221681
AA Change: M202V

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
Meta Mutation Damage Score 0.298 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 97% (29/30)
MGI Phenotype FUNCTION: This gene is a member of the large Serpin gene family. Many members of this family act as protease inhibitors, and have a conserved structure including a reactive center loop (RCL) that can act as a bait for protease targets. Unlike some members of this large gene family, the protein encoded by this gene is an intracellular protein, and lacks an N-terminal signal peptide sequence. Alternate splicing results in multiple transcript variants. A pseudogene of this gene is found on chromosome 13. [provided by RefSeq, Jul 2014]
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik T A 7: 41,625,540 N222K possibly damaging Het
Abca13 A T 11: 9,585,415 M4680L probably benign Het
Adgrv1 GA GAA 13: 81,540,132 probably null Het
Afdn T C 17: 13,883,917 S1157P probably damaging Het
Ank1 A G 8: 23,139,463 T63A probably damaging Het
Asah1 A G 8: 41,348,139 probably benign Het
Cdh18 T A 15: 23,382,962 L277I possibly damaging Het
Ces3a A T 8: 105,057,461 D431V probably damaging Het
Dbx1 T C 7: 49,636,517 S67G probably benign Het
Dmxl2 A G 9: 54,473,832 probably benign Het
Dnah7a T A 1: 53,631,681 T471S probably benign Het
Efcab8 A T 2: 153,781,806 K70N probably benign Het
Gm5434 G A 12: 36,090,636 probably benign Het
Grcc10 A T 6: 124,740,970 M1K probably null Het
Higd2a G C 13: 54,590,727 C53S probably damaging Het
Kcna4 C T 2: 107,295,914 P331L probably damaging Het
Keg1 T A 19: 12,718,943 S164T possibly damaging Het
Ltbp1 T C 17: 75,310,159 V1031A probably benign Het
Obsl1 G A 1: 75,500,099 T737I possibly damaging Het
Olfr129 G A 17: 38,054,988 L193F probably damaging Het
Olfr853 C T 9: 19,537,906 R8K probably benign Het
Olfr855 T G 9: 19,584,714 M59R probably damaging Het
Tcf19 A G 17: 35,515,925 probably null Het
Tlr11 T C 14: 50,362,527 F657L probably benign Het
Ttf2 G A 3: 100,948,225 Q96* probably null Het
Zbbx C T 3: 75,105,671 G151E probably damaging Het
Zfp810 C T 9: 22,278,892 C240Y probably damaging Het
Other mutations in Serpinb6d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01482:Serpinb6d APN 13 33671363 missense probably benign 0.05
IGL01611:Serpinb6d APN 13 33666392 nonsense probably null
IGL01946:Serpinb6d APN 13 33671386 missense probably benign 0.22
IGL02672:Serpinb6d APN 13 33671389 missense probably benign 0.36
R0041:Serpinb6d UTSW 13 33667632 missense probably damaging 0.98
R0041:Serpinb6d UTSW 13 33667632 missense probably damaging 0.98
R1112:Serpinb6d UTSW 13 33669135 missense probably damaging 1.00
R1159:Serpinb6d UTSW 13 33671229 missense probably damaging 0.98
R1447:Serpinb6d UTSW 13 33670756 missense probably benign 0.42
R1608:Serpinb6d UTSW 13 33669129 missense probably benign
R1843:Serpinb6d UTSW 13 33671381 missense probably benign
R1945:Serpinb6d UTSW 13 33667680 missense possibly damaging 0.95
R2168:Serpinb6d UTSW 13 33666374 missense probably benign 0.08
R2275:Serpinb6d UTSW 13 33671428 missense probably benign 0.00
R3737:Serpinb6d UTSW 13 33667680 missense probably damaging 1.00
R3738:Serpinb6d UTSW 13 33667680 missense probably damaging 1.00
R3739:Serpinb6d UTSW 13 33667680 missense probably damaging 1.00
R3780:Serpinb6d UTSW 13 33664114 missense probably benign
R3782:Serpinb6d UTSW 13 33664114 missense probably benign
R4685:Serpinb6d UTSW 13 33671228 missense probably damaging 1.00
R4707:Serpinb6d UTSW 13 33671353 missense possibly damaging 0.83
R4761:Serpinb6d UTSW 13 33671267 missense probably damaging 1.00
R4859:Serpinb6d UTSW 13 33667564 intron probably null
R4884:Serpinb6d UTSW 13 33666445 missense possibly damaging 0.76
R4951:Serpinb6d UTSW 13 33666383 missense probably benign 0.03
R5010:Serpinb6d UTSW 13 33671444 missense probably benign 0.15
R5081:Serpinb6d UTSW 13 33671247 missense probably benign 0.32
R6726:Serpinb6d UTSW 13 33670735 missense probably benign 0.01
R6960:Serpinb6d UTSW 13 33671198 missense probably benign 0.08
Z1088:Serpinb6d UTSW 13 33671254 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- GACATGTGAAGTTCAAACATTTTCAA -3'
(R):5'- GCCCAGGGAAGTGTGACT -3'

Sequencing Primer
(F):5'- CTCCCAGAGATCATGACAT -3'
(R):5'- CCCAGGGAAGTGTGACTTTAAC -3'
Posted On2015-04-29