Incidental Mutation 'R4002:Higd2a'
ID311319
Institutional Source Beutler Lab
Gene Symbol Higd2a
Ensembl Gene ENSMUSG00000025868
Gene NameHIG1 domain family, member 2A
Synonyms
MMRRC Submission 041609-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.683) question?
Stock #R4002 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location54590207-54591158 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 54590727 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 53 (C53S)
Ref Sequence ENSEMBL: ENSMUSP00000026986 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026986] [ENSMUST00000026987] [ENSMUST00000049575] [ENSMUST00000091609] [ENSMUST00000140142] [ENSMUST00000148222] [ENSMUST00000149462]
Predicted Effect probably damaging
Transcript: ENSMUST00000026986
AA Change: C53S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000026986
Gene: ENSMUSG00000025868
AA Change: C53S

DomainStartEndE-ValueType
Pfam:HIG_1_N 45 96 5.5e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000026987
SMART Domains Protein: ENSMUSP00000026987
Gene: ENSMUSG00000025869

DomainStartEndE-ValueType
Pfam:Nop16 4 157 7.3e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000049575
SMART Domains Protein: ENSMUSP00000053371
Gene: ENSMUSG00000047547

DomainStartEndE-ValueType
Pfam:Clathrin_lg_ch 1 228 2.9e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000091609
SMART Domains Protein: ENSMUSP00000089198
Gene: ENSMUSG00000047547

DomainStartEndE-ValueType
Pfam:Clathrin_lg_ch 1 210 8.7e-70 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140142
SMART Domains Protein: ENSMUSP00000122336
Gene: ENSMUSG00000047547

DomainStartEndE-ValueType
Pfam:Clathrin_lg_ch 1 95 2.1e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148222
SMART Domains Protein: ENSMUSP00000122180
Gene: ENSMUSG00000025869

DomainStartEndE-ValueType
Pfam:Nop16 5 88 9.9e-11 PFAM
Pfam:Nop16 67 156 1.6e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149462
Meta Mutation Damage Score 0.322 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 97% (29/30)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of the cytochrome c oxidase complex (complex IV), which is the terminal enzyme in the mitochondrial respiratory chain. The encoded protein is an inner mitochondrial membrane protein and is a functional ortholog of the yeast respiratory supercomplex factor 1 (Rcf1). In mouse, the orthologous protein enhances cell survival under conditions of hypoxia. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik T A 7: 41,625,540 N222K possibly damaging Het
Abca13 A T 11: 9,585,415 M4680L probably benign Het
Adgrv1 GA GAA 13: 81,540,132 probably null Het
Afdn T C 17: 13,883,917 S1157P probably damaging Het
Ank1 A G 8: 23,139,463 T63A probably damaging Het
Asah1 A G 8: 41,348,139 probably benign Het
Cdh18 T A 15: 23,382,962 L277I possibly damaging Het
Ces3a A T 8: 105,057,461 D431V probably damaging Het
Dbx1 T C 7: 49,636,517 S67G probably benign Het
Dmxl2 A G 9: 54,473,832 probably benign Het
Dnah7a T A 1: 53,631,681 T471S probably benign Het
Efcab8 A T 2: 153,781,806 K70N probably benign Het
Gm5434 G A 12: 36,090,636 probably benign Het
Grcc10 A T 6: 124,740,970 M1K probably null Het
Kcna4 C T 2: 107,295,914 P331L probably damaging Het
Keg1 T A 19: 12,718,943 S164T possibly damaging Het
Ltbp1 T C 17: 75,310,159 V1031A probably benign Het
Obsl1 G A 1: 75,500,099 T737I possibly damaging Het
Olfr129 G A 17: 38,054,988 L193F probably damaging Het
Olfr853 C T 9: 19,537,906 R8K probably benign Het
Olfr855 T G 9: 19,584,714 M59R probably damaging Het
Serpinb6d A G 13: 33,670,647 M202V probably damaging Het
Tcf19 A G 17: 35,515,925 probably null Het
Tlr11 T C 14: 50,362,527 F657L probably benign Het
Ttf2 G A 3: 100,948,225 Q96* probably null Het
Zbbx C T 3: 75,105,671 G151E probably damaging Het
Zfp810 C T 9: 22,278,892 C240Y probably damaging Het
Other mutations in Higd2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02138:Higd2a APN 13 54590422 splice site probably null
Predicted Primers PCR Primer
(F):5'- CAAGTAAGCCTGGGGTTTGG -3'
(R):5'- TAAGACCCGGCTATACTCAGG -3'

Sequencing Primer
(F):5'- TGTGACGAAATGACGGTGC -3'
(R):5'- GCTTGAGACTTCATAGCAGATGCC -3'
Posted On2015-04-29