Incidental Mutation 'R4002:Tcf19'
ID311325
Institutional Source Beutler Lab
Gene Symbol Tcf19
Ensembl Gene ENSMUSG00000050410
Gene Nametranscription factor 19
Synonyms
MMRRC Submission 041609-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.257) question?
Stock #R4002 (G1)
Quality Score182
Status Validated
Chromosome17
Chromosomal Location35512734-35516824 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 35515925 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000133407 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045956] [ENSMUST00000159009] [ENSMUST00000160885] [ENSMUST00000161012] [ENSMUST00000162683] [ENSMUST00000164242] [ENSMUST00000173903]
Predicted Effect probably null
Transcript: ENSMUST00000045956
SMART Domains Protein: ENSMUSP00000046612
Gene: ENSMUSG00000040312

DomainStartEndE-ValueType
Pfam:HCR 27 767 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159009
AA Change: L64P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000124449
Gene: ENSMUSG00000050410
AA Change: L64P

DomainStartEndE-ValueType
low complexity region 11 16 N/A INTRINSIC
FHA 30 88 8.28e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160885
AA Change: L64P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000125167
Gene: ENSMUSG00000050410
AA Change: L64P

DomainStartEndE-ValueType
low complexity region 11 16 N/A INTRINSIC
FHA 30 88 8.28e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161012
AA Change: L64P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000125310
Gene: ENSMUSG00000050410
AA Change: L64P

DomainStartEndE-ValueType
low complexity region 11 16 N/A INTRINSIC
FHA 30 88 8.28e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162683
AA Change: L64P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000125659
Gene: ENSMUSG00000050410
AA Change: L64P

DomainStartEndE-ValueType
low complexity region 11 16 N/A INTRINSIC
FHA 30 88 8.28e-7 SMART
Predicted Effect probably null
Transcript: ENSMUST00000164242
SMART Domains Protein: ENSMUSP00000132028
Gene: ENSMUSG00000040312

DomainStartEndE-ValueType
Pfam:HCR 27 767 N/A PFAM
Predicted Effect probably null
Transcript: ENSMUST00000173903
SMART Domains Protein: ENSMUSP00000133407
Gene: ENSMUSG00000040312

DomainStartEndE-ValueType
Pfam:HCR 110 855 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173986
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174827
Meta Mutation Damage Score 0.6344 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 97% (29/30)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains a PHD-type zinc finger domain and likely functions as a transcription factor. The encoded protein plays a role proliferation and apoptosis of pancreatic beta cells. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik T A 7: 41,625,540 N222K possibly damaging Het
Abca13 A T 11: 9,585,415 M4680L probably benign Het
Adgrv1 GA GAA 13: 81,540,132 probably null Het
Afdn T C 17: 13,883,917 S1157P probably damaging Het
Ank1 A G 8: 23,139,463 T63A probably damaging Het
Asah1 A G 8: 41,348,139 probably benign Het
Cdh18 T A 15: 23,382,962 L277I possibly damaging Het
Ces3a A T 8: 105,057,461 D431V probably damaging Het
Dbx1 T C 7: 49,636,517 S67G probably benign Het
Dmxl2 A G 9: 54,473,832 probably benign Het
Dnah7a T A 1: 53,631,681 T471S probably benign Het
Efcab8 A T 2: 153,781,806 K70N probably benign Het
Gm5434 G A 12: 36,090,636 probably benign Het
Grcc10 A T 6: 124,740,970 M1K probably null Het
Higd2a G C 13: 54,590,727 C53S probably damaging Het
Kcna4 C T 2: 107,295,914 P331L probably damaging Het
Keg1 T A 19: 12,718,943 S164T possibly damaging Het
Ltbp1 T C 17: 75,310,159 V1031A probably benign Het
Obsl1 G A 1: 75,500,099 T737I possibly damaging Het
Olfr129 G A 17: 38,054,988 L193F probably damaging Het
Olfr853 C T 9: 19,537,906 R8K probably benign Het
Olfr855 T G 9: 19,584,714 M59R probably damaging Het
Serpinb6d A G 13: 33,670,647 M202V probably damaging Het
Tlr11 T C 14: 50,362,527 F657L probably benign Het
Ttf2 G A 3: 100,948,225 Q96* probably null Het
Zbbx C T 3: 75,105,671 G151E probably damaging Het
Zfp810 C T 9: 22,278,892 C240Y probably damaging Het
Other mutations in Tcf19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02336:Tcf19 APN 17 35514483 unclassified probably null
R0348:Tcf19 UTSW 17 35515904 unclassified probably null
X0064:Tcf19 UTSW 17 35514874 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGGTGTAGGCTAAAGCAGAC -3'
(R):5'- TTTCCAGCTGCTGCGTATAG -3'

Sequencing Primer
(F):5'- GCAGACAAGCAGGTTTAGTCC -3'
(R):5'- CTGCTGCGTATAGGGGGC -3'
Posted On2015-04-29