Incidental Mutation 'R4002:Olfr129'
ID311326
Institutional Source Beutler Lab
Gene Symbol Olfr129
Ensembl Gene ENSMUSG00000081724
Gene Nameolfactory receptor 129
SynonymsGA_x6K02T2PSCP-2503741-2502776, MOR263-9
MMRRC Submission 041609-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R4002 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location38050857-38060079 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 38054988 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 193 (L193F)
Ref Sequence ENSEMBL: ENSMUSP00000149327 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000122318] [ENSMUST00000174675] [ENSMUST00000216476]
Predicted Effect probably damaging
Transcript: ENSMUST00000122318
AA Change: L202F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113564
Gene: ENSMUSG00000081724
AA Change: L202F

DomainStartEndE-ValueType
Pfam:7tm_4 46 323 4.6e-56 PFAM
Pfam:7TM_GPCR_Srsx 50 319 1.1e-5 PFAM
Pfam:7tm_1 56 305 3.2e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000174675
AA Change: L193F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133865
Gene: ENSMUSG00000060017
AA Change: L193F

DomainStartEndE-ValueType
transmembrane domain 33 55 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000216476
AA Change: L193F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.0344 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 97% (29/30)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik T A 7: 41,625,540 N222K possibly damaging Het
Abca13 A T 11: 9,585,415 M4680L probably benign Het
Adgrv1 GA GAA 13: 81,540,132 probably null Het
Afdn T C 17: 13,883,917 S1157P probably damaging Het
Ank1 A G 8: 23,139,463 T63A probably damaging Het
Asah1 A G 8: 41,348,139 probably benign Het
Cdh18 T A 15: 23,382,962 L277I possibly damaging Het
Ces3a A T 8: 105,057,461 D431V probably damaging Het
Dbx1 T C 7: 49,636,517 S67G probably benign Het
Dmxl2 A G 9: 54,473,832 probably benign Het
Dnah7a T A 1: 53,631,681 T471S probably benign Het
Efcab8 A T 2: 153,781,806 K70N probably benign Het
Gm5434 G A 12: 36,090,636 probably benign Het
Grcc10 A T 6: 124,740,970 M1K probably null Het
Higd2a G C 13: 54,590,727 C53S probably damaging Het
Kcna4 C T 2: 107,295,914 P331L probably damaging Het
Keg1 T A 19: 12,718,943 S164T possibly damaging Het
Ltbp1 T C 17: 75,310,159 V1031A probably benign Het
Obsl1 G A 1: 75,500,099 T737I possibly damaging Het
Olfr853 C T 9: 19,537,906 R8K probably benign Het
Olfr855 T G 9: 19,584,714 M59R probably damaging Het
Serpinb6d A G 13: 33,670,647 M202V probably damaging Het
Tcf19 A G 17: 35,515,925 probably null Het
Tlr11 T C 14: 50,362,527 F657L probably benign Het
Ttf2 G A 3: 100,948,225 Q96* probably null Het
Zbbx C T 3: 75,105,671 G151E probably damaging Het
Zfp810 C T 9: 22,278,892 C240Y probably damaging Het
Other mutations in Olfr129
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02140:Olfr129 APN 17 38055590 start codon destroyed probably null 0.15
IGL02163:Olfr129 APN 17 38054750 missense probably benign 0.06
IGL02374:Olfr129 APN 17 38055521 missense probably damaging 1.00
R0840:Olfr129 UTSW 17 38055572 missense probably benign 0.00
R1774:Olfr129 UTSW 17 38055437 missense probably benign 0.00
R3720:Olfr129 UTSW 17 38055368 missense probably damaging 1.00
R3794:Olfr129 UTSW 17 38054895 missense probably damaging 1.00
R3840:Olfr129 UTSW 17 38055348 missense probably damaging 1.00
R4273:Olfr129 UTSW 17 38055272 missense probably damaging 1.00
R4872:Olfr129 UTSW 17 38055576 missense probably benign
R5606:Olfr129 UTSW 17 38054802 missense probably damaging 0.98
R6309:Olfr129 UTSW 17 38055152 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCTGGTGAGTGGCTAGAC -3'
(R):5'- ATAACTGAGTGCTGCCTACTGG -3'

Sequencing Primer
(F):5'- GGGCCTCAAGTAGTTAATAGATCCTG -3'
(R):5'- ACCGCTGCATGGCCATATG -3'
Posted On2015-04-29