Incidental Mutation 'R4004:Nupl2'
ID311385
Institutional Source Beutler Lab
Gene Symbol Nupl2
Ensembl Gene ENSMUSG00000048439
Gene Namenucleoporin like 2
SynonymsCG1
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.888) question?
Stock #R4004 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location24164963-24184013 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 24182436 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 408 (I408T)
Ref Sequence ENSEMBL: ENSMUSP00000062766 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049887] [ENSMUST00000115101]
Predicted Effect probably damaging
Transcript: ENSMUST00000049887
AA Change: I408T

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000062766
Gene: ENSMUSG00000048439
AA Change: I408T

DomainStartEndE-ValueType
Blast:ZnF_C3H1 1 22 2e-10 BLAST
low complexity region 23 41 N/A INTRINSIC
coiled coil region 174 195 N/A INTRINSIC
low complexity region 266 287 N/A INTRINSIC
low complexity region 305 322 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115101
SMART Domains Protein: ENSMUSP00000110753
Gene: ENSMUSG00000048439

DomainStartEndE-ValueType
Blast:ZnF_C3H1 1 22 3e-9 BLAST
low complexity region 23 41 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124150
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan A C 7: 79,100,687 E1735D probably damaging Het
Ano2 A G 6: 126,013,279 R788G probably damaging Het
Atg9a T C 1: 75,186,451 Y335C probably damaging Het
BC067074 A G 13: 113,318,380 Q320R probably benign Het
Capn10 T A 1: 92,940,591 L260Q probably damaging Het
Ces1d A T 8: 93,178,092 F340Y probably benign Het
Ctbp2 C A 7: 132,991,773 R733L probably benign Het
Dgkd T C 1: 87,935,423 I64T possibly damaging Het
Dmxl2 T C 9: 54,446,390 I765V probably benign Het
Dync2h1 C A 9: 7,117,404 C62F probably damaging Het
F2 T C 2: 91,628,396 N523S possibly damaging Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Fcgr1 A G 3: 96,284,352 V380A probably benign Het
Gif T G 19: 11,759,007 V314G probably damaging Het
Herc2 C A 7: 56,106,465 P751Q possibly damaging Het
Ikzf3 C T 11: 98,489,017 E142K probably damaging Het
Kctd3 A G 1: 188,992,743 S214P probably benign Het
Lrpap1 T A 5: 35,105,544 K50* probably null Het
Naa11 A T 5: 97,391,793 Y169N probably benign Het
Olfr366 A T 2: 37,219,948 H153L probably benign Het
Olfr721-ps1 C T 14: 14,408,152 A308V probably benign Het
Plxnc1 G A 10: 94,794,597 Q1512* probably null Het
Ptpn14 A G 1: 189,850,510 N518S probably benign Het
Rapgef5 A G 12: 117,748,397 I740V probably damaging Het
Ric1 C T 19: 29,579,801 R429C probably benign Het
Rpn2 T C 2: 157,318,008 L548P probably damaging Het
Ryr3 C G 2: 112,675,873 R3443P probably damaging Het
Slc28a1 T C 7: 81,169,038 S580P probably damaging Het
Slco6c1 A G 1: 97,075,885 Y496H probably damaging Het
Spag5 T C 11: 78,321,529 M1101T probably benign Het
Utp11 A T 4: 124,682,437 F138I probably damaging Het
Vcp G A 4: 42,983,028 T606I probably damaging Het
Zfhx4 C T 3: 5,403,358 P2859S probably benign Het
Zfp316 A G 5: 143,255,119 S382P possibly damaging Het
Other mutations in Nupl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00684:Nupl2 APN 5 24182043 missense possibly damaging 0.92
IGL01992:Nupl2 APN 5 24181103 missense probably benign 0.01
IGL02638:Nupl2 APN 5 24175507 missense probably benign 0.03
IGL03197:Nupl2 APN 5 24167465 missense probably damaging 0.98
R1484:Nupl2 UTSW 5 24178077 missense probably benign 0.08
R2004:Nupl2 UTSW 5 24181991 nonsense probably null
R3617:Nupl2 UTSW 5 24182327 missense probably benign 0.04
R4547:Nupl2 UTSW 5 24177970 intron probably benign
R4669:Nupl2 UTSW 5 24182417 missense probably benign 0.21
R5974:Nupl2 UTSW 5 24167402 missense probably damaging 1.00
R6189:Nupl2 UTSW 5 24175454 missense probably damaging 1.00
R6315:Nupl2 UTSW 5 24167504 missense probably damaging 0.97
R6914:Nupl2 UTSW 5 24181084 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGAGAAGCGGCAGTTCTGTG -3'
(R):5'- TTCAAAGCCATTCAGAGCTTTC -3'

Sequencing Primer
(F):5'- AGTCCTAGCCCACATTCTCAGG -3'
(R):5'- GAGCTTTCTCTTGGAGGTCTC -3'
Posted On2015-04-29