Incidental Mutation 'R4005:Mcm10'
ID 311415
Institutional Source Beutler Lab
Gene Symbol Mcm10
Ensembl Gene ENSMUSG00000026669
Gene Name minichromosome maintenance 10 replication initiation factor
Synonyms C330019M07Rik, 2410041F14Rik
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4005 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 4995535-5017602 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 5005814 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Arginine at position 440 (S440R)
Ref Sequence ENSEMBL: ENSMUSP00000100050 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027980] [ENSMUST00000102985]
AlphaFold Q0VBD2
Predicted Effect probably damaging
Transcript: ENSMUST00000027980
AA Change: S440R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000027980
Gene: ENSMUSG00000026669
AA Change: S440R

DomainStartEndE-ValueType
coiled coil region 102 138 N/A INTRINSIC
low complexity region 218 228 N/A INTRINSIC
Pfam:zf-primase 398 443 2e-21 PFAM
low complexity region 480 493 N/A INTRINSIC
Mcm10 538 883 2.27e-184 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102985
AA Change: S440R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000100050
Gene: ENSMUSG00000026669
AA Change: S440R

DomainStartEndE-ValueType
coiled coil region 102 138 N/A INTRINSIC
low complexity region 218 228 N/A INTRINSIC
Pfam:zf-primase 398 443 3.7e-21 PFAM
low complexity region 480 493 N/A INTRINSIC
Mcm10 538 883 2.27e-184 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125201
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146257
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150091
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of the highly conserved mini-chromosome maintenance proteins (MCM) that are involved in the initiation of eukaryotic genome replication. The hexameric protein complex formed by MCM proteins is a key component of the pre-replication complex (pre-RC) and it may be involved in the formation of replication forks and in the recruitment of other DNA replication related proteins. This protein can interact with MCM2 and MCM6, as well as with the origin recognition protein ORC2. It is regulated by proteolysis and phosphorylation in a cell cycle-dependent manner. Studies of a similar protein in Xenopus suggest that the chromatin binding of this protein at the onset of DNA replication is after pre-RC assembly and before origin unwinding. Alternatively spliced transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced embryonic cell proliferation and early embryonic letahlity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adar T A 3: 89,657,094 (GRCm39) L488Q probably damaging Het
Ajm1 T C 2: 25,468,868 (GRCm39) T348A probably benign Het
Arhgef26 T C 3: 62,247,816 (GRCm39) M300T probably benign Het
Asl C T 5: 130,047,673 (GRCm39) probably null Het
Capn10 T A 1: 92,868,313 (GRCm39) L260Q probably damaging Het
Cdhr3 T C 12: 33,130,355 (GRCm39) D160G probably damaging Het
Cep290 A G 10: 100,374,870 (GRCm39) E1372G probably damaging Het
Cpeb2 A G 5: 43,395,755 (GRCm39) probably benign Het
Cpeb4 G A 11: 31,875,390 (GRCm39) A530T probably damaging Het
Cstl1 A T 2: 148,597,190 (GRCm39) I64F probably damaging Het
Ddx28 C G 8: 106,737,560 (GRCm39) R166P possibly damaging Het
Dgkd T C 1: 87,863,145 (GRCm39) I64T possibly damaging Het
Dmxl2 T C 9: 54,353,674 (GRCm39) I765V probably benign Het
Edem3 T C 1: 151,635,506 (GRCm39) M60T probably damaging Het
Farp1 C T 14: 121,513,809 (GRCm39) R844W probably damaging Het
Fat3 G A 9: 15,909,567 (GRCm39) S2145F probably damaging Het
Hmcn1 C G 1: 150,598,204 (GRCm39) L1699F possibly damaging Het
Igsf10 A T 3: 59,235,981 (GRCm39) L1400H probably benign Het
Ikzf3 C T 11: 98,379,843 (GRCm39) E142K probably damaging Het
Ilkap T A 1: 91,312,985 (GRCm39) N170I probably benign Het
Kctd3 T G 1: 188,734,124 (GRCm39) I39L possibly damaging Het
Lrit3 C A 3: 129,585,021 (GRCm39) V246L probably benign Het
Magi1 A G 6: 93,678,299 (GRCm39) I619T probably damaging Het
Map1b G T 13: 99,566,415 (GRCm39) P2102H unknown Het
Mtss2 CG CGG 8: 111,465,673 (GRCm39) probably null Het
Nlrp9a A G 7: 26,257,975 (GRCm39) N531S probably benign Het
Nrcam T A 12: 44,579,429 (GRCm39) D31E probably benign Het
Obscn T C 11: 59,022,472 (GRCm39) R758G possibly damaging Het
Ogn A C 13: 49,762,775 (GRCm39) E39A possibly damaging Het
Or4g17 G A 2: 111,210,088 (GRCm39) V248I probably benign Het
Or52z14 A G 7: 103,253,470 (GRCm39) Y203C probably damaging Het
Or5b94 A T 19: 12,652,210 (GRCm39) I214L probably benign Het
Pramel20 A G 4: 143,298,839 (GRCm39) T261A probably benign Het
Rgs2 T A 1: 143,877,606 (GRCm39) I150L probably benign Het
Rnf19a A T 15: 36,245,774 (GRCm39) D490E probably damaging Het
Spag5 T C 11: 78,212,355 (GRCm39) M1101T probably benign Het
Ulk4 A T 9: 120,997,265 (GRCm39) L769Q possibly damaging Het
Ythdc2 A G 18: 44,966,195 (GRCm39) S144G probably benign Het
Other mutations in Mcm10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01529:Mcm10 APN 2 5,013,439 (GRCm39) missense probably benign 0.00
IGL02028:Mcm10 APN 2 5,013,511 (GRCm39) missense possibly damaging 0.95
IGL02672:Mcm10 APN 2 5,006,092 (GRCm39) missense probably benign 0.00
IGL03352:Mcm10 APN 2 4,999,407 (GRCm39) missense probably damaging 1.00
R0055:Mcm10 UTSW 2 4,996,218 (GRCm39) missense probably damaging 1.00
R0055:Mcm10 UTSW 2 4,996,218 (GRCm39) missense probably damaging 1.00
R0320:Mcm10 UTSW 2 5,008,897 (GRCm39) missense probably benign
R0379:Mcm10 UTSW 2 5,013,434 (GRCm39) missense probably benign 0.05
R0385:Mcm10 UTSW 2 5,008,965 (GRCm39) missense possibly damaging 0.82
R0519:Mcm10 UTSW 2 5,013,356 (GRCm39) missense probably benign
R1537:Mcm10 UTSW 2 5,003,591 (GRCm39) missense possibly damaging 0.77
R1597:Mcm10 UTSW 2 5,003,563 (GRCm39) missense probably damaging 1.00
R1727:Mcm10 UTSW 2 5,011,336 (GRCm39) missense probably benign 0.10
R1758:Mcm10 UTSW 2 5,008,861 (GRCm39) missense probably damaging 1.00
R1997:Mcm10 UTSW 2 4,998,571 (GRCm39) missense probably damaging 1.00
R3618:Mcm10 UTSW 2 5,001,913 (GRCm39) critical splice donor site probably null
R4870:Mcm10 UTSW 2 5,008,970 (GRCm39) missense probably damaging 1.00
R5302:Mcm10 UTSW 2 5,012,181 (GRCm39) missense probably benign 0.12
R5488:Mcm10 UTSW 2 4,996,929 (GRCm39) missense probably damaging 1.00
R6921:Mcm10 UTSW 2 5,005,746 (GRCm39) missense probably benign 0.00
R7259:Mcm10 UTSW 2 5,011,328 (GRCm39) missense probably benign 0.02
R7353:Mcm10 UTSW 2 5,011,920 (GRCm39) missense possibly damaging 0.54
R7489:Mcm10 UTSW 2 5,006,112 (GRCm39) missense probably damaging 1.00
R7744:Mcm10 UTSW 2 4,996,253 (GRCm39) missense probably damaging 1.00
R7903:Mcm10 UTSW 2 5,000,613 (GRCm39) missense probably benign 0.00
R9021:Mcm10 UTSW 2 4,997,782 (GRCm39) missense probably benign 0.03
R9072:Mcm10 UTSW 2 5,013,414 (GRCm39) missense possibly damaging 0.63
R9073:Mcm10 UTSW 2 5,013,414 (GRCm39) missense possibly damaging 0.63
R9135:Mcm10 UTSW 2 5,011,372 (GRCm39) missense probably benign 0.01
X0020:Mcm10 UTSW 2 5,011,959 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTCCCAAGAGCAGTCAGGAG -3'
(R):5'- CAGTCAATCATGAGGGGTGAGC -3'

Sequencing Primer
(F):5'- CAGTCAGGAGAGATGCCTCAC -3'
(R):5'- CAATCATGAGGGGTGAGCTTTAG -3'
Posted On 2015-04-29