Incidental Mutation 'R4005:Adar'
ID311421
Institutional Source Beutler Lab
Gene Symbol Adar
Ensembl Gene ENSMUSG00000027951
Gene Nameadenosine deaminase, RNA-specific
SynonymsAdar1p150, ADAR1, mZaADAR, Adar1p110
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4005 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location89715022-89753446 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 89749787 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 488 (L488Q)
Ref Sequence ENSEMBL: ENSMUSP00000113453 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029562] [ENSMUST00000029563] [ENSMUST00000098924] [ENSMUST00000107405] [ENSMUST00000118341] [ENSMUST00000121094] [ENSMUST00000200558]
Predicted Effect probably benign
Transcript: ENSMUST00000029562
SMART Domains Protein: ENSMUSP00000029562
Gene: ENSMUSG00000027950

DomainStartEndE-ValueType
Pfam:Neur_chan_LBD 29 234 5.6e-75 PFAM
Pfam:Neur_chan_memb 241 477 1.7e-86 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000029563
AA Change: L980Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029563
Gene: ENSMUSG00000027951
AA Change: L980Q

DomainStartEndE-ValueType
Zalpha 134 203 8.97e-30 SMART
Zalpha 244 312 7.69e-29 SMART
low complexity region 322 337 N/A INTRINSIC
low complexity region 347 359 N/A INTRINSIC
DSRM 457 523 3.6e-21 SMART
DSRM 568 634 4.36e-20 SMART
DSRM 676 742 1.58e-17 SMART
ADEAMc 762 1145 3.74e-205 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000098924
AA Change: L758Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000096525
Gene: ENSMUSG00000027951
AA Change: L758Q

DomainStartEndE-ValueType
Zalpha 1 64 3.1e-24 SMART
low complexity region 74 89 N/A INTRINSIC
low complexity region 99 111 N/A INTRINSIC
DSRM 209 275 3.6e-21 SMART
DSRM 320 386 4.36e-20 SMART
DSRM 428 494 1.58e-17 SMART
low complexity region 515 526 N/A INTRINSIC
ADEAMc 540 923 3.74e-205 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107405
AA Change: L1006Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103028
Gene: ENSMUSG00000027951
AA Change: L1006Q

DomainStartEndE-ValueType
Zalpha 134 203 8.97e-30 SMART
Zalpha 244 312 7.69e-29 SMART
low complexity region 322 337 N/A INTRINSIC
low complexity region 347 359 N/A INTRINSIC
DSRM 457 523 3.6e-21 SMART
DSRM 568 634 4.36e-20 SMART
DSRM 676 742 1.58e-17 SMART
low complexity region 763 774 N/A INTRINSIC
ADEAMc 788 1171 3.74e-205 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000118341
AA Change: L488Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113453
Gene: ENSMUSG00000027951
AA Change: L488Q

DomainStartEndE-ValueType
DSRM 50 116 4.36e-20 SMART
DSRM 158 224 1.58e-17 SMART
low complexity region 245 256 N/A INTRINSIC
ADEAMc 270 653 3.74e-205 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000121094
AA Change: L462Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112969
Gene: ENSMUSG00000027951
AA Change: L462Q

DomainStartEndE-ValueType
DSRM 50 116 4.36e-20 SMART
DSRM 158 224 1.58e-17 SMART
ADEAMc 244 627 3.74e-205 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131030
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199372
Predicted Effect probably benign
Transcript: ENSMUST00000200558
SMART Domains Protein: ENSMUSP00000143441
Gene: ENSMUSG00000027950

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Neur_chan_LBD 29 234 1.5e-71 PFAM
Pfam:Neur_chan_memb 241 454 4.8e-61 PFAM
low complexity region 657 666 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the enzyme responsible for RNA editing by site-specific deamination of adenosines. This enzyme destabilizes double-stranded RNA through conversion of adenosine to inosine. Mutations in this gene have been associated with dyschromatosis symmetrica hereditaria. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2010]
PHENOTYPE: Homozygous null mice die during gestation. Inactivation of this locus has been associated with increased apoptosis and, in some lines, defects in both primitive and definitive hematopoiesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef26 T C 3: 62,340,395 M300T probably benign Het
Asl C T 5: 130,018,832 probably null Het
BC080695 A G 4: 143,572,269 T261A probably benign Het
Capn10 T A 1: 92,940,591 L260Q probably damaging Het
Cdhr3 T C 12: 33,080,356 D160G probably damaging Het
Cep290 A G 10: 100,539,008 E1372G probably damaging Het
Cpeb2 A G 5: 43,238,412 probably benign Het
Cpeb4 G A 11: 31,925,390 A530T probably damaging Het
Cstl1 A T 2: 148,755,270 I64F probably damaging Het
Ddx28 C G 8: 106,010,928 R166P possibly damaging Het
Dgkd T C 1: 87,935,423 I64T possibly damaging Het
Dmxl2 T C 9: 54,446,390 I765V probably benign Het
Edem3 T C 1: 151,759,755 M60T probably damaging Het
Farp1 C T 14: 121,276,397 R844W probably damaging Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Gm996 T C 2: 25,578,856 T348A probably benign Het
Hmcn1 C G 1: 150,722,453 L1699F possibly damaging Het
Igsf10 A T 3: 59,328,560 L1400H probably benign Het
Ikzf3 C T 11: 98,489,017 E142K probably damaging Het
Ilkap T A 1: 91,385,263 N170I probably benign Het
Kctd3 T G 1: 189,001,927 I39L possibly damaging Het
Lrit3 C A 3: 129,791,372 V246L probably benign Het
Magi1 A G 6: 93,701,318 I619T probably damaging Het
Map1b G T 13: 99,429,907 P2102H unknown Het
Mcm10 G T 2: 5,001,003 S440R probably damaging Het
Mtss1l CG CGG 8: 110,739,041 probably null Het
Nlrp9a A G 7: 26,558,550 N531S probably benign Het
Nrcam T A 12: 44,532,646 D31E probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Ogn A C 13: 49,609,299 E39A possibly damaging Het
Olfr1284 G A 2: 111,379,743 V248I probably benign Het
Olfr1442 A T 19: 12,674,846 I214L probably benign Het
Olfr619 A G 7: 103,604,263 Y203C probably damaging Het
Rgs2 T A 1: 144,001,868 I150L probably benign Het
Rnf19a A T 15: 36,245,628 D490E probably damaging Het
Spag5 T C 11: 78,321,529 M1101T probably benign Het
Ulk4 A T 9: 121,168,199 L769Q possibly damaging Het
Ythdc2 A G 18: 44,833,128 S144G probably benign Het
Other mutations in Adar
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01726:Adar APN 3 89730840 critical splice donor site probably null
IGL01743:Adar APN 3 89745440 nonsense probably null
IGL01982:Adar APN 3 89738090 missense probably benign 0.03
logimen UTSW 3 89730814 missense probably benign 0.04
R0153:Adar UTSW 3 89730814 missense probably benign 0.04
R0464:Adar UTSW 3 89735582 missense possibly damaging 0.90
R0674:Adar UTSW 3 89749823 intron probably benign
R0762:Adar UTSW 3 89739983 splice site probably benign
R1567:Adar UTSW 3 89735781 missense probably benign 0.19
R1807:Adar UTSW 3 89734865 missense probably benign 0.00
R1858:Adar UTSW 3 89739282 missense probably benign 0.01
R1964:Adar UTSW 3 89745895 missense probably benign 0.23
R2440:Adar UTSW 3 89734854 missense possibly damaging 0.86
R3731:Adar UTSW 3 89746655 missense probably damaging 0.99
R3854:Adar UTSW 3 89736258 missense probably damaging 1.00
R4105:Adar UTSW 3 89740094 missense probably benign 0.00
R4693:Adar UTSW 3 89735940 missense probably damaging 1.00
R4980:Adar UTSW 3 89730814 missense probably benign 0.04
R5096:Adar UTSW 3 89747291 makesense probably null
R5199:Adar UTSW 3 89745944 missense probably damaging 1.00
R5397:Adar UTSW 3 89735319 missense probably benign
R5406:Adar UTSW 3 89736111 missense probably damaging 1.00
R5411:Adar UTSW 3 89739212 missense probably benign 0.39
R5446:Adar UTSW 3 89740179 missense probably damaging 1.00
R5660:Adar UTSW 3 89735594 missense probably damaging 1.00
R5724:Adar UTSW 3 89735169 missense probably benign
R6087:Adar UTSW 3 89745590 missense probably benign 0.05
R6935:Adar UTSW 3 89747218 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CATAGTGTGCCCAGGACTTG -3'
(R):5'- CCAGTCTGGCAGGTCTTTTC -3'

Sequencing Primer
(F):5'- GGTTGCCTTCATCAATCCAAC -3'
(R):5'- GGCAGGTCTTTTCTTATTTGCTAC -3'
Posted On2015-04-29