Incidental Mutation 'R4006:1700021F07Rik'
List |< first << previous [record 17 of 9592] next >> last >|
ID311460
Institutional Source Beutler Lab
Gene Symbol 1700021F07Rik
Ensembl Gene ENSMUSG00000027518
Gene NameRIKEN cDNA 1700021F07 gene
Synonyms
MMRRC Submission 040845-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.043) question?
Stock #R4006 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location173522586-173528501 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 173526087 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000029023 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029023]
Predicted Effect probably null
Transcript: ENSMUST00000029023
SMART Domains Protein: ENSMUSP00000029023
Gene: ENSMUSG00000027518

DomainStartEndE-ValueType
Pfam:LLC1 16 134 2.1e-51 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts14 A G 10: 61,202,821 probably null Het
AI481877 A T 4: 59,076,500 V481D possibly damaging Het
Ano4 C A 10: 89,088,263 V329L probably benign Het
Camkv C T 9: 107,946,641 R196W probably damaging Het
Chd9 T C 8: 90,933,560 S383P probably benign Het
Cul4a A G 8: 13,122,859 N164S probably benign Het
Dsg4 G A 18: 20,470,965 E830K probably damaging Het
Fbln2 C A 6: 91,269,961 probably null Het
Grm8 T C 6: 27,981,230 Y227C probably damaging Het
Gsn G A 2: 35,307,621 W717* probably null Het
Htr2a A T 14: 74,642,141 H70L probably benign Het
Igfn1 C T 1: 135,982,362 probably null Het
Iqsec3 A G 6: 121,376,228 S1144P probably damaging Het
Lpin2 C T 17: 71,246,501 T878I probably damaging Het
Lrrn2 A T 1: 132,937,740 D181V probably damaging Het
Mc1r T C 8: 123,407,637 F43S probably damaging Het
Mst1 A G 9: 108,082,948 E377G possibly damaging Het
Nfatc3 T A 8: 106,108,839 I931N probably benign Het
Nup188 G A 2: 30,309,878 D305N probably damaging Het
Olfr1082 T C 2: 86,594,564 D88G probably benign Het
Olfr513 C T 7: 108,755,261 T135I probably damaging Het
Pate3 T A 9: 35,646,102 H86L probably damaging Het
Pla2r1 A T 2: 60,522,873 F248Y probably damaging Het
Ppp1r37 A G 7: 19,535,069 S169P probably damaging Het
Prame A T X: 135,613,625 L305Q probably damaging Het
Prkcg G A 7: 3,327,467 V492I probably damaging Het
Psmb11 T A 14: 54,625,646 V107E probably damaging Het
Reg1 A G 6: 78,427,030 D60G probably null Het
Syce1 C A 7: 140,779,896 L83F probably damaging Het
Trim23 A G 13: 104,187,623 T177A probably benign Het
Xkr4 A T 1: 3,421,775 F308L probably benign Het
Xylt1 A G 7: 117,475,513 I122V probably benign Het
Zan T C 5: 137,463,939 T993A unknown Het
Zbtb20 T C 16: 43,609,399 L18P probably damaging Het
Zfp292 T C 4: 34,807,744 I1767V probably benign Het
Zfp292 G T 4: 34,809,611 S1144R possibly damaging Het
Zfp317 T G 9: 19,648,037 W516G possibly damaging Het
Zfp974 G A 7: 27,912,252 T16I possibly damaging Het
Other mutations in 1700021F07Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02375:1700021F07Rik APN 2 173522703 missense probably benign 0.34
R0376:1700021F07Rik UTSW 2 173528327 missense probably benign 0.00
R0925:1700021F07Rik UTSW 2 173526074 missense probably benign 0.01
R1102:1700021F07Rik UTSW 2 173522723 missense probably damaging 1.00
R1319:1700021F07Rik UTSW 2 173527923 missense probably damaging 0.98
R3430:1700021F07Rik UTSW 2 173528273 missense possibly damaging 0.60
R5663:1700021F07Rik UTSW 2 173527897 missense probably damaging 1.00
R6347:1700021F07Rik UTSW 2 173527915 missense possibly damaging 0.77
R6362:1700021F07Rik UTSW 2 173528174 splice site probably null
R6452:1700021F07Rik UTSW 2 173527907 missense probably benign 0.15
R6453:1700021F07Rik UTSW 2 173528259 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- GTTAAGAGGCTCGGTCAAGG -3'
(R):5'- CCATGCAGGTACCAGAAGAG -3'

Sequencing Primer
(F):5'- AGATCTGCTAGCCGGTCAGTG -3'
(R):5'- CATGCAGGTACCAGAAGAGGACATC -3'
Posted On2015-04-29