Incidental Mutation 'R4008:Pkn2'
ID311561
Institutional Source Beutler Lab
Gene Symbol Pkn2
Ensembl Gene ENSMUSG00000004591
Gene Nameprotein kinase N2
SynonymsPRK2, Stk7, Prkcl2, 6030436C20Rik
MMRRC Submission 040946-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4008 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location142790902-142882004 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 142810458 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 568 (D568G)
Ref Sequence ENSEMBL: ENSMUSP00000039566 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043812] [ENSMUST00000173830] [ENSMUST00000173913] [ENSMUST00000174422]
Predicted Effect possibly damaging
Transcript: ENSMUST00000043812
AA Change: D568G

PolyPhen 2 Score 0.756 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000039566
Gene: ENSMUSG00000004591
AA Change: D568G

DomainStartEndE-ValueType
Hr1 47 110 3.61e-20 SMART
Hr1 136 204 6.1e-18 SMART
Hr1 217 285 6.05e-22 SMART
C2 329 462 2.72e-8 SMART
low complexity region 535 546 N/A INTRINSIC
low complexity region 570 578 N/A INTRINSIC
S_TKc 656 915 7.94e-100 SMART
S_TK_X 916 980 6.77e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166330
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172521
Predicted Effect probably benign
Transcript: ENSMUST00000173615
Predicted Effect probably benign
Transcript: ENSMUST00000173830
AA Change: D520G

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000133691
Gene: ENSMUSG00000004591
AA Change: D520G

DomainStartEndE-ValueType
Hr1 47 110 3.61e-20 SMART
Hr1 136 204 6.1e-18 SMART
Hr1 217 285 6.05e-22 SMART
low complexity region 364 380 N/A INTRINSIC
low complexity region 487 498 N/A INTRINSIC
low complexity region 522 530 N/A INTRINSIC
S_TKc 608 867 7.94e-100 SMART
S_TK_X 868 932 6.77e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173913
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174169
Predicted Effect probably benign
Transcript: ENSMUST00000174422
AA Change: D552G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000134559
Gene: ENSMUSG00000004591
AA Change: D552G

DomainStartEndE-ValueType
Hr1 47 110 3.61e-20 SMART
Hr1 136 204 6.1e-18 SMART
Hr1 217 285 6.05e-22 SMART
C2 329 446 2.92e-8 SMART
low complexity region 519 530 N/A INTRINSIC
low complexity region 554 562 N/A INTRINSIC
S_TKc 640 899 7.94e-100 SMART
S_TK_X 900 964 6.77e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174680
SMART Domains Protein: ENSMUSP00000134041
Gene: ENSMUSG00000004591

DomainStartEndE-ValueType
Hr1 1 67 1.33e-18 SMART
C2 72 182 3.51e-2 SMART
Meta Mutation Damage Score 0.05 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency 97% (32/33)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele display embryonic lethality during organogenesis with impaired mesenchymal cell proliferation and neural crest cell migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss2 T A 2: 155,557,628 L529Q probably damaging Het
Adsl T C 15: 80,966,156 S359P probably benign Het
Batf2 G A 19: 6,171,348 E63K probably damaging Het
Chd1l A T 3: 97,570,402 M679K probably benign Het
Clvs2 G A 10: 33,543,462 H199Y probably damaging Het
F830045P16Rik A T 2: 129,463,547 N302K probably damaging Het
H2-K1 G A 17: 33,999,551 probably benign Het
Ifit2 G T 19: 34,574,045 M328I probably benign Het
Larp7 T C 3: 127,540,870 D490G probably benign Het
Map9 T C 3: 82,359,083 Y12H probably damaging Het
Mn1 G T 5: 111,420,169 E668D probably benign Het
Mrps18c T C 5: 100,803,116 probably benign Het
Npdc1 T A 2: 25,408,980 Y237* probably null Het
Olfr1122 A T 2: 87,388,580 I292F possibly damaging Het
Olfr192 G A 16: 59,098,761 T77I unknown Het
Olfr722 A G 14: 49,895,007 L265P probably benign Het
Oprm1 A G 10: 6,832,520 M388V probably benign Het
Pwp1 A G 10: 85,882,034 T279A possibly damaging Het
Rabep2 C A 7: 126,445,374 D547E probably damaging Het
Rbm34 T C 8: 126,949,287 K426R probably benign Het
Rgs14 T G 13: 55,369,913 L8V probably damaging Het
Ripor2 A G 13: 24,696,538 H407R probably benign Het
Serpina3a A T 12: 104,118,643 D99V probably benign Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slc39a12 T C 2: 14,452,117 F603L probably damaging Het
Smg5 T C 3: 88,349,158 S244P probably benign Het
St3gal3 T C 4: 117,940,440 I252V probably benign Het
Tarsl2 T A 7: 65,678,128 D528E probably damaging Het
Try10 A G 6: 41,356,674 T118A probably benign Het
Tshr C T 12: 91,537,494 S402L probably benign Het
Other mutations in Pkn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00510:Pkn2 APN 3 142799019 missense probably damaging 1.00
IGL00852:Pkn2 APN 3 142809816 unclassified probably benign
IGL00917:Pkn2 APN 3 142853625 missense probably damaging 1.00
IGL01147:Pkn2 APN 3 142829009 missense probably benign 0.06
IGL01556:Pkn2 APN 3 142829317 missense possibly damaging 0.88
IGL01574:Pkn2 APN 3 142839231 missense possibly damaging 0.48
IGL02058:Pkn2 APN 3 142803663 missense probably damaging 0.97
IGL02136:Pkn2 APN 3 142853590 missense probably damaging 1.00
IGL02310:Pkn2 APN 3 142811580 missense probably damaging 1.00
IGL02540:Pkn2 APN 3 142809704 missense probably benign 0.01
IGL02607:Pkn2 APN 3 142794101 critical splice donor site probably null
IGL03256:Pkn2 APN 3 142803550 splice site probably null
voodoo UTSW 3 142853538 missense possibly damaging 0.78
R0001:Pkn2 UTSW 3 142828988 missense probably benign 0.00
R0048:Pkn2 UTSW 3 142810827 missense probably damaging 1.00
R0081:Pkn2 UTSW 3 142853582 missense probably damaging 1.00
R0514:Pkn2 UTSW 3 142810458 missense possibly damaging 0.76
R0670:Pkn2 UTSW 3 142839343 missense probably damaging 0.99
R0709:Pkn2 UTSW 3 142830520 missense probably damaging 0.98
R1025:Pkn2 UTSW 3 142821565 critical splice donor site probably null
R1190:Pkn2 UTSW 3 142811525 critical splice donor site probably null
R1602:Pkn2 UTSW 3 142853538 missense possibly damaging 0.78
R1729:Pkn2 UTSW 3 142810701 missense probably benign 0.00
R1756:Pkn2 UTSW 3 142810727 missense possibly damaging 0.94
R1764:Pkn2 UTSW 3 142793854 missense probably damaging 1.00
R1797:Pkn2 UTSW 3 142809528 missense probably damaging 1.00
R1833:Pkn2 UTSW 3 142821647 missense probably damaging 1.00
R2035:Pkn2 UTSW 3 142820587 missense probably damaging 0.99
R2058:Pkn2 UTSW 3 142853471 missense possibly damaging 0.93
R3779:Pkn2 UTSW 3 142793980 missense possibly damaging 0.89
R3940:Pkn2 UTSW 3 142793911 missense probably damaging 1.00
R3967:Pkn2 UTSW 3 142809677 missense probably damaging 0.98
R4160:Pkn2 UTSW 3 142803564 missense probably benign 0.42
R4222:Pkn2 UTSW 3 142793866 nonsense probably null
R4243:Pkn2 UTSW 3 142820578 missense possibly damaging 0.64
R4380:Pkn2 UTSW 3 142830456 unclassified probably benign
R4826:Pkn2 UTSW 3 142809509 missense probably damaging 1.00
R4869:Pkn2 UTSW 3 142803618 missense probably damaging 1.00
R5096:Pkn2 UTSW 3 142839331 missense probably damaging 0.99
R5175:Pkn2 UTSW 3 142798923 missense probably damaging 1.00
R5301:Pkn2 UTSW 3 142839206 critical splice donor site probably null
R5839:Pkn2 UTSW 3 142821529 missense probably benign 0.02
R6155:Pkn2 UTSW 3 142853693 missense probably benign 0.00
R6198:Pkn2 UTSW 3 142810404 missense probably benign 0.00
R6255:Pkn2 UTSW 3 142811599 missense probably damaging 1.00
R6293:Pkn2 UTSW 3 142809704 missense probably benign 0.15
R6494:Pkn2 UTSW 3 142803668 missense possibly damaging 0.94
R6659:Pkn2 UTSW 3 142803587 missense probably damaging 1.00
R6809:Pkn2 UTSW 3 142799004 missense probably damaging 1.00
R7267:Pkn2 UTSW 3 142812015 missense possibly damaging 0.90
R7367:Pkn2 UTSW 3 142810727 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTGCAATGTACATGTTAGCCAC -3'
(R):5'- CGGCCAGGTACTTGTCTTAG -3'

Sequencing Primer
(F):5'- AATGTACATGTTAGCCACTATAATGG -3'
(R):5'- AAGGCTTGAGTGTATCTTCCATAGCC -3'
Posted On2015-04-29