Incidental Mutation 'R4011:Gm11487'
ID311683
Institutional Source Beutler Lab
Gene Symbol Gm11487
Ensembl Gene ENSMUSG00000066137
Gene Namepredicted gene 11487
Synonyms
MMRRC Submission 040948-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.253) question?
Stock #R4011 (G1)
Quality Score217
Status Not validated
Chromosome4
Chromosomal Location73401032-73405072 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 73401810 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 244 (Y244C)
Ref Sequence ENSEMBL: ENSMUSP00000081520 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084480]
Predicted Effect probably damaging
Transcript: ENSMUST00000084480
AA Change: Y244C

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000081520
Gene: ENSMUSG00000066137
AA Change: Y244C

DomainStartEndE-ValueType
low complexity region 69 84 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147434
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.7%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: This gene belongs to a family of related genes tandemly arranged in two clusters on chromosome 4. This family, which appears to be mouse-specific and composed of multiple highly similar members, is supported by limited transcript data. Members of the family maintain an intact open reading frame although the encoded protein has no known function. This gene is inferred from alignment of paralogous transcripts. [provided by RefSeq, Apr 2013]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 G A 11: 9,622,013 probably benign Het
Acss2 T A 2: 155,557,628 L529Q probably damaging Het
Adsl T C 15: 80,966,156 S359P probably benign Het
C1qtnf1 G A 11: 118,446,539 G65D probably benign Het
Chd1l A T 3: 97,570,402 M679K probably benign Het
Cspg4 A G 9: 56,887,317 T779A probably benign Het
Ddx18 T C 1: 121,562,081 I200V probably benign Het
Dnah9 T A 11: 65,834,464 M4288L probably damaging Het
F830045P16Rik A T 2: 129,463,547 N302K probably damaging Het
Gas1 T G 13: 60,175,977 D322A unknown Het
Gfm2 T A 13: 97,143,100 probably benign Het
Gm5592 G T 7: 41,289,510 V739L probably benign Het
Hbb-bh2 T A 7: 103,840,209 H45L probably benign Het
Ifit2 G T 19: 34,574,045 M328I probably benign Het
Igdcc4 T C 9: 65,135,479 V1237A probably benign Het
Kat2b G A 17: 53,644,741 probably null Het
Lmtk2 A G 5: 144,175,879 N1139S probably benign Het
Map1a G A 2: 121,300,127 A475T probably damaging Het
Map3k20 G A 2: 72,384,124 probably benign Het
Mga T C 2: 119,931,780 V1084A probably damaging Het
Myo3b A G 2: 70,096,376 I5V probably benign Het
Olfr110 T C 17: 37,499,491 V280A possibly damaging Het
Olfr1118 A G 2: 87,309,211 I141V probably benign Het
Olfr1122 A T 2: 87,388,580 I292F possibly damaging Het
Olfr192 G A 16: 59,098,761 T77I unknown Het
Olfr512 A T 7: 108,714,159 I269L probably benign Het
Olfr657 A G 7: 104,636,348 T225A probably benign Het
Osmr G T 15: 6,824,533 R565S probably benign Het
Pcolce G T 5: 137,605,774 Q344K probably benign Het
Prdm11 A G 2: 93,012,830 F95L probably damaging Het
Psd2 C T 18: 35,987,247 T383I probably benign Het
Reg3a G A 6: 78,383,570 D164N probably damaging Het
Serpina3a A T 12: 104,118,643 D99V probably benign Het
Sgce G T 6: 4,691,563 Y301* probably null Het
Slc28a3 T C 13: 58,566,250 K434E probably benign Het
Slc30a3 A G 5: 31,086,859 F360L probably damaging Het
Tdpoz3 A T 3: 93,826,243 Y75F possibly damaging Het
Trim65 A G 11: 116,127,703 F249L probably benign Het
Tubgcp3 A T 8: 12,639,634 L544* probably null Het
Vit C T 17: 78,534,692 probably benign Het
Wdfy4 C A 14: 33,102,680 probably benign Het
Xpo6 T C 7: 126,140,608 K431E probably benign Het
Xrn1 T A 9: 95,985,225 Y545* probably null Het
Other mutations in Gm11487
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02373:Gm11487 APN 4 73403643 missense probably benign 0.01
IGL03275:Gm11487 APN 4 73403416 missense possibly damaging 0.80
R1066:Gm11487 UTSW 4 73401829 missense possibly damaging 0.46
R1274:Gm11487 UTSW 4 73403076 missense probably damaging 0.97
R1742:Gm11487 UTSW 4 73401210 missense probably damaging 1.00
R1863:Gm11487 UTSW 4 73401800 nonsense probably null
R1903:Gm11487 UTSW 4 73403438 missense probably damaging 0.98
R2027:Gm11487 UTSW 4 73403058 missense possibly damaging 0.46
R4801:Gm11487 UTSW 4 73401267 nonsense probably null
R4802:Gm11487 UTSW 4 73401267 nonsense probably null
R5213:Gm11487 UTSW 4 73401334 missense probably damaging 0.96
R5334:Gm11487 UTSW 4 73403517 missense probably benign 0.31
R5345:Gm11487 UTSW 4 73401277 missense probably damaging 1.00
R6093:Gm11487 UTSW 4 73402021 missense probably benign 0.05
R6786:Gm11487 UTSW 4 73403606 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- TGTATGCAACAACACAGACCTG -3'
(R):5'- AAGATCTTCCTGCAGGAGTGG -3'

Sequencing Primer
(F):5'- ACCTGTGGGAATGGGGC -3'
(R):5'- TTGAACGGGAATTTGGCCACC -3'
Posted On2015-04-29