Incidental Mutation 'R0384:Kndc1'
ID31173
Institutional Source Beutler Lab
Gene Symbol Kndc1
Ensembl Gene ENSMUSG00000066129
Gene Namekinase non-catalytic C-lobe domain (KIND) containing 1
SynonymsB830014K08Rik, 2410012C07Rik, very-kind, VKIND
MMRRC Submission 038590-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0384 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location139894696-139941537 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 139910599 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 339 (N339I)
Ref Sequence ENSEMBL: ENSMUSP00000113856 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053445] [ENSMUST00000121839]
Predicted Effect probably benign
Transcript: ENSMUST00000053445
AA Change: N339I

PolyPhen 2 Score 0.355 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000050586
Gene: ENSMUSG00000066129
AA Change: N339I

DomainStartEndE-ValueType
KIND 37 217 4.66e-65 SMART
Blast:KIND 381 454 2e-10 BLAST
KIND 456 620 1.22e-50 SMART
low complexity region 658 670 N/A INTRINSIC
low complexity region 755 771 N/A INTRINSIC
low complexity region 792 801 N/A INTRINSIC
low complexity region 949 965 N/A INTRINSIC
coiled coil region 1121 1151 N/A INTRINSIC
Pfam:RasGEF_N 1242 1341 2.2e-17 PFAM
Pfam:RasGEF 1464 1672 3.8e-22 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000121839
AA Change: N339I

PolyPhen 2 Score 0.847 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000113856
Gene: ENSMUSG00000066129
AA Change: N339I

DomainStartEndE-ValueType
KIND 37 217 4.66e-65 SMART
Blast:KIND 381 454 2e-10 BLAST
low complexity region 455 465 N/A INTRINSIC
Blast:KIND 466 539 7e-32 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154782
Meta Mutation Damage Score 0.0548 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 91.7%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a Ras guanine nucleotide exchange factor that appears to negatively regulate dendritic growth in the brain. Knockdown of this gene in senescent umbilical vein endothelial cells partially reversed the senescence, showing that this gene could potentially be targeted by anti-aging therapies. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and overtly normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam8 T A 7: 139,986,812 probably benign Het
Akr1b8 T C 6: 34,364,330 probably benign Het
Arhgef39 A G 4: 43,498,613 L117P probably damaging Het
Atp13a1 A T 8: 69,797,324 Q356L possibly damaging Het
Bmp2k T A 5: 97,031,125 probably benign Het
Ccdc141 A G 2: 77,027,648 V1063A probably damaging Het
Col20a1 T C 2: 180,999,162 Y568H probably benign Het
Crabp2 T C 3: 87,953,021 V134A possibly damaging Het
Cyp19a1 T C 9: 54,172,741 K265E probably benign Het
Cyp2j9 T C 4: 96,585,885 H106R probably benign Het
Dcps T C 9: 35,175,943 K9R probably damaging Het
Dnajc6 C T 4: 101,598,956 T47I probably damaging Het
Dnhd1 T G 7: 105,720,114 S4315A possibly damaging Het
Dnmt3l A T 10: 78,052,737 I158F possibly damaging Het
Dock3 A G 9: 106,901,895 probably benign Het
Eefsec A G 6: 88,281,650 probably null Het
Fam204a T C 19: 60,221,296 M1V probably null Het
Fam98b T C 2: 117,267,847 V266A possibly damaging Het
Fat2 A T 11: 55,269,465 I3274N possibly damaging Het
Fbxo18 A G 2: 11,749,578 I198T probably damaging Het
Fer T C 17: 63,924,184 probably benign Het
Fhad1 T A 4: 142,002,426 M89L probably benign Het
Fjx1 C A 2: 102,451,107 C161F probably damaging Het
Fkbp7 T A 2: 76,665,824 probably benign Het
Gm42669 T A 5: 107,508,798 C976S probably benign Het
Gm4845 T C 1: 141,257,085 noncoding transcript Het
Herc1 T A 9: 66,481,050 probably benign Het
Hook3 C T 8: 26,044,235 probably null Het
Idh2 C T 7: 80,098,257 A232T probably damaging Het
Itga2b A T 11: 102,465,362 probably null Het
Klk1b21 T C 7: 44,105,493 Y71H probably benign Het
Ky C T 9: 102,542,090 T432I probably benign Het
Map4 C T 9: 110,034,628 T307I probably damaging Het
Matn1 T C 4: 130,944,476 L18P probably benign Het
Mindy4 G A 6: 55,216,684 D121N probably damaging Het
Mpv17l A T 16: 13,940,999 I96L probably benign Het
Msto1 G A 3: 88,910,339 Q441* probably null Het
Muc5ac A G 7: 141,812,251 H2048R possibly damaging Het
Musk T C 4: 58,373,711 *879Q probably null Het
Nat8f2 T C 6: 85,868,368 Y4C possibly damaging Het
Ncaph2 T A 15: 89,369,391 I282N probably benign Het
Nid1 A G 13: 13,463,836 T114A probably benign Het
Npr1 C A 3: 90,465,167 G113C probably damaging Het
Nrxn1 G A 17: 90,208,347 P193S probably damaging Het
Nwd2 T C 5: 63,805,682 F870L probably benign Het
Olfr1076 T A 2: 86,509,383 I308K possibly damaging Het
Olfr1228 A G 2: 89,249,070 I208T possibly damaging Het
Olfr55 A G 17: 33,176,548 I45V probably damaging Het
Olfr787 T A 10: 129,463,040 Y121* probably null Het
Phf14 A G 6: 11,997,020 probably benign Het
Pnpla5 G T 15: 84,120,719 L144M probably damaging Het
Prdm2 T C 4: 143,135,688 E344G probably benign Het
Psmd12 T C 11: 107,485,721 V61A probably benign Het
Relt T C 7: 100,847,505 D385G probably benign Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Scg2 T A 1: 79,435,549 I446F probably benign Het
Sema3b G A 9: 107,600,966 L407F probably damaging Het
Slc25a13 A T 6: 6,042,600 Y601* probably null Het
Sun5 C T 2: 153,858,965 V270I probably benign Het
Tex52 A G 6: 128,379,533 Y63C probably damaging Het
Tmem138 A G 19: 10,574,822 probably benign Het
Tnpo3 A G 6: 29,582,164 probably null Het
Tspoap1 A T 11: 87,766,454 Q364L probably damaging Het
Ttc41 T C 10: 86,763,947 L1037P probably damaging Het
Ugcg T A 4: 59,220,387 D393E possibly damaging Het
Vmn1r184 T C 7: 26,267,651 I274T probably benign Het
Vmn2r27 A G 6: 124,223,912 V362A probably benign Het
Vmn2r87 T A 10: 130,471,843 Y842F probably benign Het
Vps8 T A 16: 21,506,825 probably benign Het
Other mutations in Kndc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Kndc1 APN 7 139901988 splice site probably benign
IGL01061:Kndc1 APN 7 139922694 missense probably benign 0.00
IGL01099:Kndc1 APN 7 139920784 missense probably damaging 1.00
IGL01522:Kndc1 APN 7 139913972 splice site probably benign
IGL01767:Kndc1 APN 7 139930046 missense probably damaging 1.00
IGL01884:Kndc1 APN 7 139914194 missense probably damaging 1.00
IGL01932:Kndc1 APN 7 139923790 missense probably damaging 0.98
IGL02133:Kndc1 APN 7 139920767 missense probably benign 0.19
IGL02411:Kndc1 APN 7 139921913 critical splice donor site probably null
IGL02472:Kndc1 APN 7 139910901 missense probably benign 0.01
IGL02537:Kndc1 APN 7 139910410 missense probably benign 0.01
IGL02708:Kndc1 APN 7 139901181 missense probably damaging 1.00
IGL03115:Kndc1 APN 7 139921509 missense probably benign 0.28
IGL03160:Kndc1 APN 7 139920689 nonsense probably null
IGL03138:Kndc1 UTSW 7 139939878 missense possibly damaging 0.89
PIT4142001:Kndc1 UTSW 7 139923776 frame shift probably null
PIT4696001:Kndc1 UTSW 7 139932917 missense probably damaging 1.00
R0349:Kndc1 UTSW 7 139910304 missense probably benign 0.00
R0415:Kndc1 UTSW 7 139930124 missense probably damaging 1.00
R0421:Kndc1 UTSW 7 139908996 missense probably damaging 1.00
R0487:Kndc1 UTSW 7 139914023 missense probably null 0.19
R0530:Kndc1 UTSW 7 139901237 missense probably damaging 1.00
R0905:Kndc1 UTSW 7 139923735 missense possibly damaging 0.94
R1434:Kndc1 UTSW 7 139922684 missense probably damaging 1.00
R1608:Kndc1 UTSW 7 139927408 missense possibly damaging 0.80
R1644:Kndc1 UTSW 7 139930756 missense probably damaging 1.00
R1835:Kndc1 UTSW 7 139927711 missense probably damaging 0.99
R2012:Kndc1 UTSW 7 139921280 missense possibly damaging 0.90
R2102:Kndc1 UTSW 7 139930761 missense probably benign 0.02
R2103:Kndc1 UTSW 7 139921234 missense probably benign 0.01
R2128:Kndc1 UTSW 7 139930112 missense probably damaging 1.00
R2516:Kndc1 UTSW 7 139921822 missense probably damaging 1.00
R3030:Kndc1 UTSW 7 139901207 missense probably damaging 1.00
R3617:Kndc1 UTSW 7 139902060 splice site probably benign
R3747:Kndc1 UTSW 7 139927904 critical splice donor site probably null
R3848:Kndc1 UTSW 7 139908977 missense probably damaging 1.00
R4028:Kndc1 UTSW 7 139930028 missense probably damaging 0.98
R4043:Kndc1 UTSW 7 139924129 missense probably benign 0.06
R4044:Kndc1 UTSW 7 139924129 missense probably benign 0.06
R4095:Kndc1 UTSW 7 139937025 missense possibly damaging 0.49
R4289:Kndc1 UTSW 7 139910882 missense probably benign 0.01
R4478:Kndc1 UTSW 7 139920684 missense probably damaging 1.00
R4514:Kndc1 UTSW 7 139910286 missense probably benign 0.00
R4540:Kndc1 UTSW 7 139921427 nonsense probably null
R4584:Kndc1 UTSW 7 139901243 missense probably damaging 1.00
R4693:Kndc1 UTSW 7 139921779 missense probably benign 0.02
R4705:Kndc1 UTSW 7 139930123 missense possibly damaging 0.81
R4773:Kndc1 UTSW 7 139924031 nonsense probably null
R4859:Kndc1 UTSW 7 139921905 missense probably benign 0.03
R5004:Kndc1 UTSW 7 139932879 nonsense probably null
R5037:Kndc1 UTSW 7 139910455 missense possibly damaging 0.52
R5322:Kndc1 UTSW 7 139936809 missense probably damaging 1.00
R5428:Kndc1 UTSW 7 139908962 missense probably damaging 0.99
R5503:Kndc1 UTSW 7 139931889 missense probably damaging 1.00
R5506:Kndc1 UTSW 7 139927891 missense probably damaging 1.00
R5525:Kndc1 UTSW 7 139924111 missense probably benign 0.00
R5888:Kndc1 UTSW 7 139895217 missense probably benign 0.00
R5942:Kndc1 UTSW 7 139936879 missense probably damaging 1.00
R5979:Kndc1 UTSW 7 139939827 missense probably benign 0.05
R5990:Kndc1 UTSW 7 139927420 missense probably damaging 0.99
R6038:Kndc1 UTSW 7 139923775 frame shift probably null
R6076:Kndc1 UTSW 7 139902038 missense probably damaging 1.00
R6118:Kndc1 UTSW 7 139923802 missense probably damaging 1.00
R6151:Kndc1 UTSW 7 139921213 missense probably benign 0.04
R6276:Kndc1 UTSW 7 139921063 missense probably benign
R6367:Kndc1 UTSW 7 139913506 missense probably damaging 1.00
R6726:Kndc1 UTSW 7 139922751 critical splice donor site probably null
R6745:Kndc1 UTSW 7 139920976 missense probably benign 0.02
R6886:Kndc1 UTSW 7 139913569 missense probably benign 0.01
R6912:Kndc1 UTSW 7 139910278 missense probably damaging 0.99
R7070:Kndc1 UTSW 7 139921828 missense probably damaging 1.00
R7123:Kndc1 UTSW 7 139936836 missense probably damaging 0.99
R7158:Kndc1 UTSW 7 139931860 missense possibly damaging 0.48
R7248:Kndc1 UTSW 7 139920783 missense probably damaging 1.00
R7437:Kndc1 UTSW 7 139909043 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTGTCAGCCCCTGTGAGAAATG -3'
(R):5'- AGGAGATGAAGCCTCTAGTTGCCC -3'

Sequencing Primer
(F):5'- CCCCTGTGAGAAATGGTGAG -3'
(R):5'- AGGCCCCTGGACTCCTG -3'
Posted On2013-04-24