Incidental Mutation 'R4014:Smarca2'
ID311887
Institutional Source Beutler Lab
Gene Symbol Smarca2
Ensembl Gene ENSMUSG00000024921
Gene NameSWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2
SynonymsSnf2l2, brm, 2610209L14Rik
MMRRC Submission 040951-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4014 (G1)
Quality Score162
Status Validated
Chromosome19
Chromosomal Location26605050-26778322 bp(+) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) G to A at 26683927 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000025862] [ENSMUST00000099537] [ENSMUST00000176030] [ENSMUST00000176769]
Predicted Effect probably null
Transcript: ENSMUST00000025862
SMART Domains Protein: ENSMUSP00000025862
Gene: ENSMUSG00000024921

DomainStartEndE-ValueType
low complexity region 11 58 N/A INTRINSIC
low complexity region 98 113 N/A INTRINSIC
low complexity region 135 154 N/A INTRINSIC
QLQ 172 208 2.58e-13 SMART
low complexity region 216 264 N/A INTRINSIC
low complexity region 290 314 N/A INTRINSIC
low complexity region 394 405 N/A INTRINSIC
HSA 447 519 1.44e-28 SMART
low complexity region 559 579 N/A INTRINSIC
BRK 601 645 1.9e-19 SMART
DEXDc 731 923 1.34e-36 SMART
Blast:DEXDc 934 966 8e-10 BLAST
low complexity region 1005 1014 N/A INTRINSIC
HELICc 1091 1175 3.84e-23 SMART
low complexity region 1233 1248 N/A INTRINSIC
SnAC 1269 1337 7.29e-28 SMART
low complexity region 1344 1366 N/A INTRINSIC
BROMO 1391 1501 3.13e-41 SMART
low complexity region 1502 1524 N/A INTRINSIC
low complexity region 1526 1540 N/A INTRINSIC
low complexity region 1564 1576 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099537
SMART Domains Protein: ENSMUSP00000097135
Gene: ENSMUSG00000024921

DomainStartEndE-ValueType
low complexity region 11 58 N/A INTRINSIC
low complexity region 98 113 N/A INTRINSIC
low complexity region 135 154 N/A INTRINSIC
QLQ 172 208 2.58e-13 SMART
low complexity region 216 264 N/A INTRINSIC
low complexity region 290 314 N/A INTRINSIC
low complexity region 394 405 N/A INTRINSIC
HSA 447 519 1.44e-28 SMART
low complexity region 559 579 N/A INTRINSIC
BRK 601 645 1.9e-19 SMART
DEXDc 731 923 1.34e-36 SMART
Blast:DEXDc 934 966 7e-10 BLAST
low complexity region 1005 1014 N/A INTRINSIC
HELICc 1091 1175 3.84e-23 SMART
low complexity region 1233 1248 N/A INTRINSIC
SnAC 1269 1337 7.29e-28 SMART
low complexity region 1344 1366 N/A INTRINSIC
PDB:2DAT|A 1389 1410 1e-6 PDB
low complexity region 1480 1508 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175935
Predicted Effect probably null
Transcript: ENSMUST00000176030
SMART Domains Protein: ENSMUSP00000135784
Gene: ENSMUSG00000024921

DomainStartEndE-ValueType
low complexity region 11 58 N/A INTRINSIC
low complexity region 98 113 N/A INTRINSIC
low complexity region 135 154 N/A INTRINSIC
QLQ 172 208 2.58e-13 SMART
low complexity region 216 264 N/A INTRINSIC
low complexity region 290 314 N/A INTRINSIC
low complexity region 394 405 N/A INTRINSIC
HSA 447 519 1.44e-28 SMART
low complexity region 559 579 N/A INTRINSIC
BRK 601 645 1.9e-19 SMART
DEXDc 731 923 1.34e-36 SMART
Blast:DEXDc 934 966 8e-10 BLAST
low complexity region 1005 1014 N/A INTRINSIC
HELICc 1091 1175 3.84e-23 SMART
low complexity region 1233 1248 N/A INTRINSIC
SnAC 1269 1337 7.29e-28 SMART
low complexity region 1344 1366 N/A INTRINSIC
BROMO 1391 1519 1.74e-39 SMART
low complexity region 1520 1542 N/A INTRINSIC
low complexity region 1544 1558 N/A INTRINSIC
low complexity region 1582 1594 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000176769
SMART Domains Protein: ENSMUSP00000135017
Gene: ENSMUSG00000024921

DomainStartEndE-ValueType
low complexity region 11 58 N/A INTRINSIC
low complexity region 98 113 N/A INTRINSIC
low complexity region 135 154 N/A INTRINSIC
QLQ 172 208 2.58e-13 SMART
low complexity region 216 264 N/A INTRINSIC
low complexity region 290 314 N/A INTRINSIC
low complexity region 394 405 N/A INTRINSIC
HSA 447 519 1.44e-28 SMART
low complexity region 559 579 N/A INTRINSIC
BRK 601 645 1.9e-19 SMART
DEXDc 731 908 4.18e-24 SMART
low complexity region 947 956 N/A INTRINSIC
HELICc 1033 1117 3.84e-23 SMART
low complexity region 1175 1190 N/A INTRINSIC
SnAC 1211 1279 7.29e-28 SMART
low complexity region 1286 1308 N/A INTRINSIC
BROMO 1333 1443 3.13e-41 SMART
low complexity region 1444 1466 N/A INTRINSIC
low complexity region 1468 1482 N/A INTRINSIC
low complexity region 1506 1518 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000208303
Meta Mutation Damage Score 0.6304 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.6%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SWI/SNF family of proteins and is highly similar to the brahma protein of Drosophila. Members of this family have helicase and ATPase activities and are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein is part of the large ATP-dependent chromatin remodeling complex SNF/SWI, which is required for transcriptional activation of genes normally repressed by chromatin. Alternatively spliced transcript variants encoding different isoforms have been found for this gene, which contains a trinucleotide repeat (CAG) length polymorphism. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a targeted mutation in this gene may exhibit infertility and a slightly increased body weight in some genetic backgrounds. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 A T 19: 43,823,120 Q1008L probably benign Het
Adgrg7 A G 16: 56,742,288 F562S probably damaging Het
Alms1 T A 6: 85,678,352 N3293K probably benign Het
Cdk20 T A 13: 64,437,505 V201D probably benign Het
Cenpf A G 1: 189,653,159 V2308A probably benign Het
Chek1 T C 9: 36,722,754 probably benign Het
Ciz1 G T 2: 32,374,344 E497D probably damaging Het
Clcn6 A G 4: 148,017,610 F339S probably damaging Het
Dctpp1 G A 7: 127,257,113 R146C probably damaging Het
Dennd5a C T 7: 109,935,481 probably null Het
Dmxl1 G A 18: 49,863,962 V442I probably benign Het
Dmxl2 C A 9: 54,378,709 probably null Het
Dnah11 A G 12: 117,974,914 I3273T probably benign Het
Dnhd1 T A 7: 105,714,838 D4132E probably damaging Het
Dst G A 1: 34,191,282 W2327* probably null Het
Epb41 A T 4: 131,982,445 probably benign Het
Frem2 C T 3: 53,652,353 V1578I probably benign Het
Fsip2 A G 2: 82,983,518 T3394A probably benign Het
Gabra5 C T 7: 57,489,010 D97N probably damaging Het
Habp2 A G 19: 56,319,622 E546G probably benign Het
Hace1 A G 10: 45,588,374 probably benign Het
Herc4 T C 10: 63,287,544 S433P probably benign Het
Igf2bp2 T C 16: 22,063,676 N425S probably damaging Het
Krt26 C T 11: 99,335,302 G189S probably damaging Het
Lama2 A T 10: 26,984,376 D3038E probably damaging Het
Lmbrd2 T C 15: 9,151,585 probably benign Het
Lrp1b A G 2: 40,802,984 F3401L possibly damaging Het
Map2k7 T A 8: 4,247,663 S421R possibly damaging Het
Matn1 A G 4: 130,951,947 Q304R possibly damaging Het
Muc4 C T 16: 32,755,273 probably benign Het
Muc5b G A 7: 141,863,630 V3438M probably benign Het
Myo3a A G 2: 22,578,170 R479G possibly damaging Het
Mzf1 A G 7: 13,043,956 V586A possibly damaging Het
Olfr1016 A T 2: 85,799,476 Y265N probably damaging Het
Olfr834 T C 9: 18,988,882 V298A probably benign Het
Pcdhgb7 A T 18: 37,752,363 E195D probably benign Het
Pde4b A G 4: 102,555,625 D199G probably benign Het
Rnf213 C T 11: 119,445,729 Q3309* probably null Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Slc22a4 C G 11: 53,997,392 C270S probably benign Het
Spata31d1c T C 13: 65,035,399 S252P probably damaging Het
Tyr A G 7: 87,437,940 S455P probably benign Het
Urb1 A T 16: 90,769,465 M1478K probably damaging Het
Usp1 A G 4: 98,934,702 D751G probably damaging Het
Vmn1r214 G A 13: 23,035,350 C338Y probably benign Het
Vmn2r103 A G 17: 19,793,604 I219M possibly damaging Het
Wwp2 A G 8: 107,485,621 N139S probably benign Het
Other mutations in Smarca2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01368:Smarca2 APN 19 26774294 missense possibly damaging 0.82
IGL01907:Smarca2 APN 19 26698465 missense possibly damaging 0.59
IGL02039:Smarca2 APN 19 26716137 missense probably damaging 1.00
IGL02110:Smarca2 APN 19 26672740 missense possibly damaging 0.96
IGL02561:Smarca2 APN 19 26716182 missense possibly damaging 0.92
IGL02649:Smarca2 APN 19 26640586 missense possibly damaging 0.73
IGL02880:Smarca2 APN 19 26676624 splice site probably benign
IGL03028:Smarca2 APN 19 26678312 splice site probably benign
IGL03187:Smarca2 APN 19 26672824 missense probably damaging 0.98
IGL03213:Smarca2 APN 19 26623975 missense probably damaging 1.00
IGL03354:Smarca2 APN 19 26619903 missense probably benign 0.01
FR4737:Smarca2 UTSW 19 26630999 unclassified probably benign
PIT1430001:Smarca2 UTSW 19 26649093 missense probably benign 0.35
R0184:Smarca2 UTSW 19 26692249 nonsense probably null
R0306:Smarca2 UTSW 19 26640613 missense probably damaging 1.00
R0538:Smarca2 UTSW 19 26691362 missense probably damaging 0.99
R0565:Smarca2 UTSW 19 26681875 missense possibly damaging 0.71
R0610:Smarca2 UTSW 19 26691391 missense probably damaging 1.00
R0669:Smarca2 UTSW 19 26706200 missense possibly damaging 0.51
R0726:Smarca2 UTSW 19 26698403 missense probably damaging 1.00
R1184:Smarca2 UTSW 19 26770933 splice site probably benign
R1256:Smarca2 UTSW 19 26681973 missense probably benign 0.06
R1299:Smarca2 UTSW 19 26771611 critical splice donor site probably null
R1306:Smarca2 UTSW 19 26770988 missense possibly damaging 0.81
R1381:Smarca2 UTSW 19 26630828 missense probably damaging 1.00
R1400:Smarca2 UTSW 19 26676740 missense probably damaging 0.98
R1415:Smarca2 UTSW 19 26710684 missense probably null 0.72
R1496:Smarca2 UTSW 19 26631101 missense possibly damaging 0.85
R1582:Smarca2 UTSW 19 26751905 missense probably damaging 0.99
R1666:Smarca2 UTSW 19 26647034 missense possibly damaging 0.65
R1668:Smarca2 UTSW 19 26647034 missense possibly damaging 0.65
R1751:Smarca2 UTSW 19 26640380 splice site probably benign
R1861:Smarca2 UTSW 19 26623884 missense probably benign 0.03
R1962:Smarca2 UTSW 19 26672724 nonsense probably null
R1964:Smarca2 UTSW 19 26672724 nonsense probably null
R1998:Smarca2 UTSW 19 26631093 missense probably benign 0.33
R2014:Smarca2 UTSW 19 26683905 missense possibly damaging 0.86
R2255:Smarca2 UTSW 19 26771038 missense probably benign 0.01
R2392:Smarca2 UTSW 19 26640650 critical splice donor site probably null
R2439:Smarca2 UTSW 19 26691454 critical splice donor site probably null
R3030:Smarca2 UTSW 19 26752029 missense possibly damaging 0.84
R3195:Smarca2 UTSW 19 26683822 missense possibly damaging 0.85
R3430:Smarca2 UTSW 19 26691349 missense probably damaging 1.00
R3710:Smarca2 UTSW 19 26668890 unclassified probably benign
R3845:Smarca2 UTSW 19 26720873 missense probably benign 0.06
R4013:Smarca2 UTSW 19 26683927 splice site probably null
R4016:Smarca2 UTSW 19 26683927 splice site probably null
R4271:Smarca2 UTSW 19 26720949 critical splice donor site probably null
R4471:Smarca2 UTSW 19 26619877 missense possibly damaging 0.86
R4612:Smarca2 UTSW 19 26776225 missense possibly damaging 0.70
R4730:Smarca2 UTSW 19 26630673 missense probably damaging 1.00
R4755:Smarca2 UTSW 19 26654483 missense possibly damaging 0.86
R4999:Smarca2 UTSW 19 26720855 nonsense probably null
R5015:Smarca2 UTSW 19 26691388 missense possibly damaging 0.86
R5320:Smarca2 UTSW 19 26691372 missense probably damaging 1.00
R5393:Smarca2 UTSW 19 26640429 missense probably benign 0.18
R5503:Smarca2 UTSW 19 26623936 missense probably damaging 0.96
R5503:Smarca2 UTSW 19 26682046 missense possibly damaging 0.93
R5715:Smarca2 UTSW 19 26649122 missense probably benign 0.16
R5790:Smarca2 UTSW 19 26676724 missense probably damaging 1.00
R5874:Smarca2 UTSW 19 26776069 intron probably benign
R6209:Smarca2 UTSW 19 26771004 nonsense probably null
R6236:Smarca2 UTSW 19 26696213 missense probably benign 0.33
R6291:Smarca2 UTSW 19 26630892 missense probably damaging 1.00
R6292:Smarca2 UTSW 19 26630892 missense probably damaging 1.00
R6325:Smarca2 UTSW 19 26678363 missense probably damaging 0.99
R6544:Smarca2 UTSW 19 26630931 missense probably damaging 1.00
R6572:Smarca2 UTSW 19 26679173 missense possibly damaging 0.71
R6589:Smarca2 UTSW 19 26619884 missense possibly damaging 0.53
R6601:Smarca2 UTSW 19 26654377 missense probably benign 0.30
R6804:Smarca2 UTSW 19 26751886 missense possibly damaging 0.93
R6922:Smarca2 UTSW 19 26691349 missense probably damaging 1.00
R7047:Smarca2 UTSW 19 26669155 missense possibly damaging 0.83
R7213:Smarca2 UTSW 19 26647131 missense possibly damaging 0.96
R7257:Smarca2 UTSW 19 26654464 nonsense probably null
R7259:Smarca2 UTSW 19 26654464 nonsense probably null
X0061:Smarca2 UTSW 19 26720840 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGCATGTGTGATTTCAGTAGGC -3'
(R):5'- AGACTGAAAATGGGATGCCC -3'

Sequencing Primer
(F):5'- GTGATTTCAGTAGGCAATGAAATCC -3'
(R):5'- CCCCCACACACCCCAGC -3'
Posted On2015-04-29