Incidental Mutation 'R4015:Sult6b2'
ID311903
Institutional Source Beutler Lab
Gene Symbol Sult6b2
Ensembl Gene ENSMUSG00000048473
Gene Namesulfotransferase family 6B, member 2
SynonymsLOC330440, Gm766
MMRRC Submission 040952-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.124) question?
Stock #R4015 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location142785204-142804502 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 142790262 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 202 (N202I)
Ref Sequence ENSEMBL: ENSMUSP00000107398 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111768] [ENSMUST00000156662]
Predicted Effect possibly damaging
Transcript: ENSMUST00000111768
AA Change: N202I

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000107398
Gene: ENSMUSG00000048473
AA Change: N202I

DomainStartEndE-ValueType
Pfam:Sulfotransfer_1 37 276 1.5e-64 PFAM
Pfam:Sulfotransfer_3 38 200 1.6e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156662
SMART Domains Protein: ENSMUSP00000138527
Gene: ENSMUSG00000048473

DomainStartEndE-ValueType
Pfam:Sulfotransfer_1 74 157 5.6e-21 PFAM
Meta Mutation Damage Score 0.1152 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.5%
Validation Efficiency 97% (38/39)
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb6 C T 1: 75,174,491 probably null Het
Cacna1e T C 1: 154,482,585 D580G probably damaging Het
Ccdc66 A G 14: 27,483,836 I898T probably damaging Het
Celf3 T C 3: 94,487,198 V202A probably benign Het
Cfap161 C T 7: 83,780,271 G180S probably benign Het
Col5a2 T C 1: 45,403,471 I605V probably benign Het
Coq6 A G 12: 84,366,897 H67R probably benign Het
Cyp2b19 T C 7: 26,762,343 F196S probably damaging Het
Cyp4a14 G T 4: 115,491,134 P382Q probably damaging Het
Dctpp1 G A 7: 127,257,113 R146C probably damaging Het
Ddias T C 7: 92,859,861 K282R probably benign Het
Dnah10 A G 5: 124,777,926 Q1965R probably benign Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Igf2bp2 T C 16: 22,063,676 N425S probably damaging Het
Lrp1b A G 2: 40,802,984 F3401L possibly damaging Het
Mocs2 T C 13: 114,820,798 probably benign Het
Muc5b G A 7: 141,863,630 V3438M probably benign Het
Myo3a A G 2: 22,578,170 R479G possibly damaging Het
Nalcn T G 14: 123,486,387 E422A probably damaging Het
Pcdh17 T C 14: 84,447,107 V338A probably damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rbm12b1 T C 4: 12,145,491 S488P probably benign Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Srcap C A 7: 127,525,423 P255Q probably benign Het
Tcf7l1 A G 6: 72,636,399 probably benign Het
Tef T C 15: 81,823,605 V261A probably damaging Het
Trio C T 15: 27,744,101 V2582I possibly damaging Het
Tyr A G 7: 87,437,940 S455P probably benign Het
Uggt2 T C 14: 119,026,433 N1062D possibly damaging Het
Unc13b G A 4: 43,237,801 G3441R probably damaging Het
Vmn1r214 G A 13: 23,035,350 C338Y probably benign Het
Wdr70 A T 15: 8,079,214 C149* probably null Het
Zfp867 A G 11: 59,463,694 F270L probably damaging Het
Other mutations in Sult6b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00436:Sult6b2 APN 6 142797837 splice site probably benign
IGL00694:Sult6b2 APN 6 142790289 missense possibly damaging 0.92
IGL01146:Sult6b2 APN 6 142804308 missense probably benign 0.00
IGL01886:Sult6b2 APN 6 142790126 critical splice donor site probably null
IGL02385:Sult6b2 APN 6 142801772 missense probably benign 0.01
IGL02477:Sult6b2 APN 6 142801721 missense probably damaging 1.00
R0088:Sult6b2 UTSW 6 142797949 missense probably damaging 1.00
R2850:Sult6b2 UTSW 6 142797887 missense probably benign 0.18
R4667:Sult6b2 UTSW 6 142801695 nonsense probably null
R5172:Sult6b2 UTSW 6 142797931 missense probably damaging 1.00
R5973:Sult6b2 UTSW 6 142790295 missense probably benign 0.01
R6152:Sult6b2 UTSW 6 142804376 missense probably benign 0.00
R6893:Sult6b2 UTSW 6 142804299 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- ATCCGCAGCAAAAGCCTTAG -3'
(R):5'- CTGGAACCAAATTAAGAGAGAACTC -3'

Sequencing Primer
(F):5'- AGCTGCAGCCCCTTCCTG -3'
(R):5'- TAGTGAGTTCTAGACCACCCAGG -3'
Posted On2015-04-29