Incidental Mutation 'R4015:Dctpp1'
ID311908
Institutional Source Beutler Lab
Gene Symbol Dctpp1
Ensembl Gene ENSMUSG00000042462
Gene NamedCTP pyrophosphatase 1
SynonymsRS21-C6, 2410015N17Rik
MMRRC Submission 040952-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.359) question?
Stock #R4015 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location127256959-127260709 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 127257113 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 146 (R146C)
Ref Sequence ENSEMBL: ENSMUSP00000047845 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035276] [ENSMUST00000052509] [ENSMUST00000205583]
PDB Structure
X-Ray Structure of Protein from Mus Musculus MM.29898 [X-RAY DIFFRACTION]
Crystal structure of RS21-C6 core segment RSCUT [X-RAY DIFFRACTION]
Crystal structure of RS21-C6 core segment and dm5CTP complex [X-RAY DIFFRACTION]
Ensemble refinement of the crystal structure of protein from Mus musculus Mm.29898 [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000035276
AA Change: R146C

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000047845
Gene: ENSMUSG00000042462
AA Change: R146C

DomainStartEndE-ValueType
Pfam:MazG 51 132 7.2e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000052509
SMART Domains Protein: ENSMUSP00000056959
Gene: ENSMUSG00000054716

DomainStartEndE-ValueType
low complexity region 4 40 N/A INTRINSIC
ZnF_C2H2 63 85 1.82e-3 SMART
ZnF_C2H2 91 113 4.72e-2 SMART
ZnF_C2H2 119 141 5.67e-5 SMART
ZnF_C2H2 147 169 4.17e-3 SMART
ZnF_C2H2 175 197 5.5e-3 SMART
ZnF_C2H2 203 225 1.45e-2 SMART
ZnF_C2H2 231 253 2.95e-3 SMART
ZnF_C2H2 259 281 9.58e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000205583
Meta Mutation Damage Score 0.0564 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.5%
Validation Efficiency 97% (38/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is dCTP pyrophosphatase, which converts dCTP to dCMP and inorganic pyrophosphate. The encoded protein also displays weak activity against dTTP and dATP, but none against dGTP. This protein may be responsible for eliminating excess dCTP after DNA synthesis and may prevent overmethylation of CpG islands. Three transcript variants, one protein-coding and the other two non-protein coding, have been found for this gene. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb6 C T 1: 75,174,491 probably null Het
Cacna1e T C 1: 154,482,585 D580G probably damaging Het
Ccdc66 A G 14: 27,483,836 I898T probably damaging Het
Celf3 T C 3: 94,487,198 V202A probably benign Het
Cfap161 C T 7: 83,780,271 G180S probably benign Het
Col5a2 T C 1: 45,403,471 I605V probably benign Het
Coq6 A G 12: 84,366,897 H67R probably benign Het
Cyp2b19 T C 7: 26,762,343 F196S probably damaging Het
Cyp4a14 G T 4: 115,491,134 P382Q probably damaging Het
Ddias T C 7: 92,859,861 K282R probably benign Het
Dnah10 A G 5: 124,777,926 Q1965R probably benign Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Igf2bp2 T C 16: 22,063,676 N425S probably damaging Het
Lrp1b A G 2: 40,802,984 F3401L possibly damaging Het
Mocs2 T C 13: 114,820,798 probably benign Het
Muc5b G A 7: 141,863,630 V3438M probably benign Het
Myo3a A G 2: 22,578,170 R479G possibly damaging Het
Nalcn T G 14: 123,486,387 E422A probably damaging Het
Pcdh17 T C 14: 84,447,107 V338A probably damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rbm12b1 T C 4: 12,145,491 S488P probably benign Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Srcap C A 7: 127,525,423 P255Q probably benign Het
Sult6b2 T A 6: 142,790,262 N202I possibly damaging Het
Tcf7l1 A G 6: 72,636,399 probably benign Het
Tef T C 15: 81,823,605 V261A probably damaging Het
Trio C T 15: 27,744,101 V2582I possibly damaging Het
Tyr A G 7: 87,437,940 S455P probably benign Het
Uggt2 T C 14: 119,026,433 N1062D possibly damaging Het
Unc13b G A 4: 43,237,801 G3441R probably damaging Het
Vmn1r214 G A 13: 23,035,350 C338Y probably benign Het
Wdr70 A T 15: 8,079,214 C149* probably null Het
Zfp867 A G 11: 59,463,694 F270L probably damaging Het
Other mutations in Dctpp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0624:Dctpp1 UTSW 7 127257193 missense probably damaging 0.99
R4014:Dctpp1 UTSW 7 127257113 missense probably damaging 0.97
R4016:Dctpp1 UTSW 7 127257113 missense probably damaging 0.97
R4017:Dctpp1 UTSW 7 127257113 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- ACTGGACAGTACCCCACTTC -3'
(R):5'- AAAGGAGAGAGCAGCCCTTC -3'

Sequencing Primer
(F):5'- CCACTTCTCTGCAGGATTTGAG -3'
(R):5'- CTTCAGGAGGAGCTTAGCGAC -3'
Posted On2015-04-29