Incidental Mutation 'R4015:Zfp867'
ID311913
Institutional Source Beutler Lab
Gene Symbol Zfp867
Ensembl Gene ENSMUSG00000054519
Gene Namezinc finger protein 867
Synonyms
MMRRC Submission 040952-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R4015 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location59461197-59472474 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 59463694 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 270 (F270L)
Ref Sequence ENSEMBL: ENSMUSP00000050746 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057799]
Predicted Effect probably damaging
Transcript: ENSMUST00000057799
AA Change: F270L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000050746
Gene: ENSMUSG00000054519
AA Change: F270L

DomainStartEndE-ValueType
KRAB 12 70 1.36e-16 SMART
low complexity region 84 90 N/A INTRINSIC
ZnF_C2H2 121 143 4.47e-3 SMART
ZnF_C2H2 149 171 5.59e-4 SMART
ZnF_C2H2 177 199 5.5e-3 SMART
ZnF_C2H2 205 227 5.14e-3 SMART
ZnF_C2H2 233 255 1.2e-3 SMART
ZnF_C2H2 261 283 5.5e-3 SMART
ZnF_C2H2 289 311 1.38e-3 SMART
ZnF_C2H2 317 339 5.42e-2 SMART
ZnF_C2H2 346 368 1.47e-3 SMART
ZnF_C2H2 374 396 7.11e0 SMART
ZnF_C2H2 402 424 1.69e-3 SMART
Meta Mutation Damage Score 0.372 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.5%
Validation Efficiency 97% (38/39)
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb6 C T 1: 75,174,491 probably null Het
Cacna1e T C 1: 154,482,585 D580G probably damaging Het
Ccdc66 A G 14: 27,483,836 I898T probably damaging Het
Celf3 T C 3: 94,487,198 V202A probably benign Het
Cfap161 C T 7: 83,780,271 G180S probably benign Het
Col5a2 T C 1: 45,403,471 I605V probably benign Het
Coq6 A G 12: 84,366,897 H67R probably benign Het
Cyp2b19 T C 7: 26,762,343 F196S probably damaging Het
Cyp4a14 G T 4: 115,491,134 P382Q probably damaging Het
Dctpp1 G A 7: 127,257,113 R146C probably damaging Het
Ddias T C 7: 92,859,861 K282R probably benign Het
Dnah10 A G 5: 124,777,926 Q1965R probably benign Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Igf2bp2 T C 16: 22,063,676 N425S probably damaging Het
Lrp1b A G 2: 40,802,984 F3401L possibly damaging Het
Mocs2 T C 13: 114,820,798 probably benign Het
Muc5b G A 7: 141,863,630 V3438M probably benign Het
Myo3a A G 2: 22,578,170 R479G possibly damaging Het
Nalcn T G 14: 123,486,387 E422A probably damaging Het
Pcdh17 T C 14: 84,447,107 V338A probably damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rbm12b1 T C 4: 12,145,491 S488P probably benign Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Srcap C A 7: 127,525,423 P255Q probably benign Het
Sult6b2 T A 6: 142,790,262 N202I possibly damaging Het
Tcf7l1 A G 6: 72,636,399 probably benign Het
Tef T C 15: 81,823,605 V261A probably damaging Het
Trio C T 15: 27,744,101 V2582I possibly damaging Het
Tyr A G 7: 87,437,940 S455P probably benign Het
Uggt2 T C 14: 119,026,433 N1062D possibly damaging Het
Unc13b G A 4: 43,237,801 G3441R probably damaging Het
Vmn1r214 G A 13: 23,035,350 C338Y probably benign Het
Wdr70 A T 15: 8,079,214 C149* probably null Het
Other mutations in Zfp867
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03156:Zfp867 APN 11 59465008 splice site probably benign
IGL03338:Zfp867 APN 11 59464177 nonsense probably null
R0040:Zfp867 UTSW 11 59463865 missense possibly damaging 0.88
R1997:Zfp867 UTSW 11 59463591 missense probably damaging 0.98
R2251:Zfp867 UTSW 11 59465493 nonsense probably null
R4429:Zfp867 UTSW 11 59465037 missense possibly damaging 0.55
R4697:Zfp867 UTSW 11 59463661 missense probably damaging 1.00
R7428:Zfp867 UTSW 11 59463934 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CCTAAGGGAAGTGGAGCAAC -3'
(R):5'- TCATTTCCCCAGTGAGTTCAG -3'

Sequencing Primer
(F):5'- CTCTCCAGCATGAGATGACTGATG -3'
(R):5'- TCACACTGGGGAGAAGCCTTATTC -3'
Posted On2015-04-29