Incidental Mutation 'R4015:Mocs2'
ID311917
Institutional Source Beutler Lab
Gene Symbol Mocs2
Ensembl Gene ENSMUSG00000015536
Gene Namemolybdenum cofactor synthesis 2
Synonyms
MMRRC Submission 040952-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4015 (G1)
Quality Score213
Status Validated
Chromosome13
Chromosomal Location114818236-114832275 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 114820798 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000138856 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015680] [ENSMUST00000164737] [ENSMUST00000164871] [ENSMUST00000165022] [ENSMUST00000166104] [ENSMUST00000166176] [ENSMUST00000183407] [ENSMUST00000184046] [ENSMUST00000184214] [ENSMUST00000184245] [ENSMUST00000184335] [ENSMUST00000184672] [ENSMUST00000184781]
Predicted Effect probably benign
Transcript: ENSMUST00000015680
SMART Domains Protein: ENSMUSP00000015680
Gene: ENSMUSG00000015536

DomainStartEndE-ValueType
Pfam:MoaE 49 161 7.1e-43 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000050131
Predicted Effect probably benign
Transcript: ENSMUST00000164737
SMART Domains Protein: ENSMUSP00000133069
Gene: ENSMUSG00000015536

DomainStartEndE-ValueType
Pfam:MoaE 46 97 3.1e-12 PFAM
Pfam:MoaE 94 130 7.2e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164871
SMART Domains Protein: ENSMUSP00000131816
Gene: ENSMUSG00000015536

DomainStartEndE-ValueType
PDB:4AP8|D 38 75 1e-14 PDB
SCOP:d1fm0e_ 44 75 1e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165022
SMART Domains Protein: ENSMUSP00000128965
Gene: ENSMUSG00000015536

DomainStartEndE-ValueType
Pfam:ThiS 9 88 1.1e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165669
Predicted Effect probably benign
Transcript: ENSMUST00000166104
SMART Domains Protein: ENSMUSP00000129021
Gene: ENSMUSG00000015536

DomainStartEndE-ValueType
Pfam:ThiS 9 88 1.1e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166176
SMART Domains Protein: ENSMUSP00000125797
Gene: ENSMUSG00000015536

DomainStartEndE-ValueType
Pfam:MoaE 46 162 5.8e-42 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170985
Predicted Effect probably benign
Transcript: ENSMUST00000183407
SMART Domains Protein: ENSMUSP00000139011
Gene: ENSMUSG00000015536

DomainStartEndE-ValueType
Pfam:ThiS 9 88 1.1e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000184046
Predicted Effect probably benign
Transcript: ENSMUST00000184214
SMART Domains Protein: ENSMUSP00000139285
Gene: ENSMUSG00000015536

DomainStartEndE-ValueType
Pfam:ThiS 9 88 1.1e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000184245
SMART Domains Protein: ENSMUSP00000139355
Gene: ENSMUSG00000015536

DomainStartEndE-ValueType
Pfam:ThiS 9 88 1.1e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184282
Predicted Effect probably benign
Transcript: ENSMUST00000184335
SMART Domains Protein: ENSMUSP00000139064
Gene: ENSMUSG00000015536

DomainStartEndE-ValueType
Pfam:ThiS 9 88 1.1e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000184672
SMART Domains Protein: ENSMUSP00000139298
Gene: ENSMUSG00000015536

DomainStartEndE-ValueType
Pfam:MoaE 46 162 5.8e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000184781
SMART Domains Protein: ENSMUSP00000138856
Gene: ENSMUSG00000015536

DomainStartEndE-ValueType
Pfam:ThiS 9 88 1.1e-19 PFAM
Meta Mutation Damage Score 0.0612 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.5%
Validation Efficiency 97% (38/39)
MGI Phenotype FUNCTION: Eukaryotic molybdoenzymes use a unique molybdenum cofactor (MoCo) consisting of a pterin, termed molybdopterin, and the catalytically active metal molybdenum. MoCo is synthesized from precursor Z by the heterodimeric enzyme molybdopterin synthase. The large and small subunits of molybdopterin synthase are both encoded from this gene by overlapping open reading frames. The proteins were initially thought to be encoded from a bicistronic transcript. Based on experiments with the human molybdopterin synthase ortholog, they are now thought to be encoded from monocistronic transcripts. Alternatively spliced transcripts have been found for this locus that encode the large and small subunits. [provided by RefSeq, Jul 2008]
PHENOTYPE: Nullizygous mice show inactivity of all molybdenum-dependent enzymes, slow weight gain, weakness, curly whiskers, hair growth and skin abnormalities, altered levels of purines, uric acid and S-sulfocysteine, bladder and kidney stone formation, increased neuronal apoptosis, and postnatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb6 C T 1: 75,174,491 probably null Het
Cacna1e T C 1: 154,482,585 D580G probably damaging Het
Ccdc66 A G 14: 27,483,836 I898T probably damaging Het
Celf3 T C 3: 94,487,198 V202A probably benign Het
Cfap161 C T 7: 83,780,271 G180S probably benign Het
Col5a2 T C 1: 45,403,471 I605V probably benign Het
Coq6 A G 12: 84,366,897 H67R probably benign Het
Cyp2b19 T C 7: 26,762,343 F196S probably damaging Het
Cyp4a14 G T 4: 115,491,134 P382Q probably damaging Het
Dctpp1 G A 7: 127,257,113 R146C probably damaging Het
Ddias T C 7: 92,859,861 K282R probably benign Het
Dnah10 A G 5: 124,777,926 Q1965R probably benign Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Igf2bp2 T C 16: 22,063,676 N425S probably damaging Het
Lrp1b A G 2: 40,802,984 F3401L possibly damaging Het
Muc5b G A 7: 141,863,630 V3438M probably benign Het
Myo3a A G 2: 22,578,170 R479G possibly damaging Het
Nalcn T G 14: 123,486,387 E422A probably damaging Het
Pcdh17 T C 14: 84,447,107 V338A probably damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rbm12b1 T C 4: 12,145,491 S488P probably benign Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Srcap C A 7: 127,525,423 P255Q probably benign Het
Sult6b2 T A 6: 142,790,262 N202I possibly damaging Het
Tcf7l1 A G 6: 72,636,399 probably benign Het
Tef T C 15: 81,823,605 V261A probably damaging Het
Trio C T 15: 27,744,101 V2582I possibly damaging Het
Tyr A G 7: 87,437,940 S455P probably benign Het
Uggt2 T C 14: 119,026,433 N1062D possibly damaging Het
Unc13b G A 4: 43,237,801 G3441R probably damaging Het
Vmn1r214 G A 13: 23,035,350 C338Y probably benign Het
Wdr70 A T 15: 8,079,214 C149* probably null Het
Zfp867 A G 11: 59,463,694 F270L probably damaging Het
Other mutations in Mocs2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1605:Mocs2 UTSW 13 114824584 missense probably benign 0.03
R1623:Mocs2 UTSW 13 114824622 missense probably benign 0.02
R3881:Mocs2 UTSW 13 114819346 nonsense probably null
R3957:Mocs2 UTSW 13 114825267 critical splice donor site probably null
R5765:Mocs2 UTSW 13 114826156 critical splice acceptor site probably null
R5781:Mocs2 UTSW 13 114820919 missense probably damaging 1.00
R6750:Mocs2 UTSW 13 114826248 missense probably damaging 0.98
R6829:Mocs2 UTSW 13 114819444 missense probably benign 0.01
R7157:Mocs2 UTSW 13 114824607 missense probably benign 0.11
R7428:Mocs2 UTSW 13 114820864 missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- ATGATAGTTCCTATCTTCCCACTGG -3'
(R):5'- TCGGTAAAGGACTGGTGCAG -3'

Sequencing Primer
(F):5'- ACTGGCCTTAGCTTTAGAGTAACC -3'
(R):5'- ACCATGCGCAAGGTATCCTGAG -3'
Posted On2015-04-29