Incidental Mutation 'R4015:Pcdh17'
ID311919
Institutional Source Beutler Lab
Gene Symbol Pcdh17
Ensembl Gene ENSMUSG00000035566
Gene Nameprotocadherin 17
SynonymsC030033F14Rik, LOC219228
MMRRC Submission 040952-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.255) question?
Stock #R4015 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location84443563-84539002 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 84447107 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 338 (V338A)
Ref Sequence ENSEMBL: ENSMUSP00000071325 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071370]
Predicted Effect probably damaging
Transcript: ENSMUST00000071370
AA Change: V338A

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000071325
Gene: ENSMUSG00000035566
AA Change: V338A

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
CA 54 131 6.8e-4 SMART
CA 155 242 8.81e-21 SMART
CA 266 350 8.27e-26 SMART
CA 375 468 9.14e-28 SMART
CA 492 579 8.4e-27 SMART
CA 608 687 2.53e-12 SMART
low complexity region 703 725 N/A INTRINSIC
low complexity region 751 759 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226362
Meta Mutation Damage Score 0.208 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.5%
Validation Efficiency 97% (38/39)
MGI Phenotype FUNCTION: This gene belongs to the protocadherin gene family, a subfamily of the cadherin superfamily. The encoded protein contains six extracellular cadherin domains, a transmembrane domain, and a cytoplasmic tail differing from those of the classical cadherins. The encoded protein may play a role in the establishment and function of specific cell-cell connections in the brain. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired synaptic transmission, increased synaptic vesicle number and decreased depression-related behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb6 C T 1: 75,174,491 probably null Het
Cacna1e T C 1: 154,482,585 D580G probably damaging Het
Ccdc66 A G 14: 27,483,836 I898T probably damaging Het
Celf3 T C 3: 94,487,198 V202A probably benign Het
Cfap161 C T 7: 83,780,271 G180S probably benign Het
Col5a2 T C 1: 45,403,471 I605V probably benign Het
Coq6 A G 12: 84,366,897 H67R probably benign Het
Cyp2b19 T C 7: 26,762,343 F196S probably damaging Het
Cyp4a14 G T 4: 115,491,134 P382Q probably damaging Het
Dctpp1 G A 7: 127,257,113 R146C probably damaging Het
Ddias T C 7: 92,859,861 K282R probably benign Het
Dnah10 A G 5: 124,777,926 Q1965R probably benign Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Igf2bp2 T C 16: 22,063,676 N425S probably damaging Het
Lrp1b A G 2: 40,802,984 F3401L possibly damaging Het
Mocs2 T C 13: 114,820,798 probably benign Het
Muc5b G A 7: 141,863,630 V3438M probably benign Het
Myo3a A G 2: 22,578,170 R479G possibly damaging Het
Nalcn T G 14: 123,486,387 E422A probably damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rbm12b1 T C 4: 12,145,491 S488P probably benign Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Srcap C A 7: 127,525,423 P255Q probably benign Het
Sult6b2 T A 6: 142,790,262 N202I possibly damaging Het
Tcf7l1 A G 6: 72,636,399 probably benign Het
Tef T C 15: 81,823,605 V261A probably damaging Het
Trio C T 15: 27,744,101 V2582I possibly damaging Het
Tyr A G 7: 87,437,940 S455P probably benign Het
Uggt2 T C 14: 119,026,433 N1062D possibly damaging Het
Unc13b G A 4: 43,237,801 G3441R probably damaging Het
Vmn1r214 G A 13: 23,035,350 C338Y probably benign Het
Wdr70 A T 15: 8,079,214 C149* probably null Het
Zfp867 A G 11: 59,463,694 F270L probably damaging Het
Other mutations in Pcdh17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Pcdh17 APN 14 84447544 missense probably damaging 1.00
IGL00902:Pcdh17 APN 14 84446849 missense probably damaging 1.00
IGL01596:Pcdh17 APN 14 84448192 missense probably damaging 1.00
IGL01665:Pcdh17 APN 14 84447002 missense probably damaging 0.99
IGL01944:Pcdh17 APN 14 84447520 missense probably benign 0.01
IGL01944:Pcdh17 APN 14 84447521 missense probably damaging 0.98
IGL01977:Pcdh17 APN 14 84533097 missense possibly damaging 0.49
IGL01988:Pcdh17 APN 14 84446622 missense probably damaging 1.00
IGL02168:Pcdh17 APN 14 84533195 missense probably benign 0.19
IGL02500:Pcdh17 APN 14 84533469 missense probably benign 0.17
IGL02874:Pcdh17 APN 14 84448240 missense possibly damaging 0.71
IGL02882:Pcdh17 APN 14 84446661 missense probably damaging 0.98
IGL02941:Pcdh17 APN 14 84448307 missense probably damaging 1.00
IGL03328:Pcdh17 APN 14 84533111 missense probably benign
PIT4151001:Pcdh17 UTSW 14 84447358 missense probably benign 0.05
R0226:Pcdh17 UTSW 14 84448201 missense probably damaging 0.99
R0537:Pcdh17 UTSW 14 84447457 missense probably damaging 1.00
R0647:Pcdh17 UTSW 14 84447773 missense possibly damaging 0.58
R0939:Pcdh17 UTSW 14 84447755 missense probably damaging 1.00
R1014:Pcdh17 UTSW 14 84447488 missense probably damaging 1.00
R1753:Pcdh17 UTSW 14 84477654 missense probably benign 0.17
R3404:Pcdh17 UTSW 14 84446622 missense probably damaging 1.00
R3405:Pcdh17 UTSW 14 84446622 missense probably damaging 1.00
R3406:Pcdh17 UTSW 14 84446622 missense probably damaging 1.00
R3746:Pcdh17 UTSW 14 84533037 missense probably benign 0.02
R3852:Pcdh17 UTSW 14 84447259 nonsense probably null
R4348:Pcdh17 UTSW 14 84447620 missense probably damaging 0.97
R4365:Pcdh17 UTSW 14 84448286 missense probably damaging 0.97
R4375:Pcdh17 UTSW 14 84448271 missense possibly damaging 0.80
R4693:Pcdh17 UTSW 14 84533520 missense probably damaging 1.00
R4811:Pcdh17 UTSW 14 84447935 missense probably damaging 1.00
R5007:Pcdh17 UTSW 14 84533297 missense probably benign
R5074:Pcdh17 UTSW 14 84533342 missense probably benign
R5080:Pcdh17 UTSW 14 84533310 missense probably benign 0.01
R5138:Pcdh17 UTSW 14 84447209 missense probably damaging 1.00
R5330:Pcdh17 UTSW 14 84533046 missense probably damaging 1.00
R5541:Pcdh17 UTSW 14 84447416 missense probably damaging 0.97
R5686:Pcdh17 UTSW 14 84532993 missense probably damaging 1.00
R5692:Pcdh17 UTSW 14 84448540 missense probably benign 0.22
R5695:Pcdh17 UTSW 14 84446360 missense probably damaging 1.00
R5949:Pcdh17 UTSW 14 84447556 missense probably damaging 1.00
R6127:Pcdh17 UTSW 14 84533060 missense probably damaging 0.96
R6294:Pcdh17 UTSW 14 84477668 missense probably benign 0.01
R6508:Pcdh17 UTSW 14 84447979 missense probably damaging 1.00
R6726:Pcdh17 UTSW 14 84446217 missense probably damaging 1.00
R7094:Pcdh17 UTSW 14 84447395 missense probably damaging 1.00
R7137:Pcdh17 UTSW 14 84533549 missense possibly damaging 0.65
X0025:Pcdh17 UTSW 14 84446562 missense possibly damaging 0.86
X0026:Pcdh17 UTSW 14 84533097 missense possibly damaging 0.49
X0027:Pcdh17 UTSW 14 84448310 missense possibly damaging 0.80
Z1088:Pcdh17 UTSW 14 84448274 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- AGAAGTCCTCTACTCCTTCAGC -3'
(R):5'- TTCAAGCTTGAAGGGGACGG -3'

Sequencing Primer
(F):5'- TTCAGCAGCTATGTGCCCG -3'
(R):5'- CTTGAAGGGGACGGAACCG -3'
Posted On2015-04-29