Incidental Mutation 'R0384:Fer'
ID31195
Institutional Source Beutler Lab
Gene Symbol Fer
Ensembl Gene ENSMUSG00000000127
Gene Namefer (fms/fps related) protein kinase
SynonymsFert, Fert2
MMRRC Submission 038590-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0384 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location63896018-64139494 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 63924184 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000000129 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000129]
Predicted Effect probably benign
Transcript: ENSMUST00000000129
SMART Domains Protein: ENSMUSP00000000129
Gene: ENSMUSG00000000127

DomainStartEndE-ValueType
FCH 1 92 1.29e-27 SMART
coiled coil region 123 174 N/A INTRINSIC
low complexity region 283 294 N/A INTRINSIC
coiled coil region 308 381 N/A INTRINSIC
SH2 459 538 5.9e-30 SMART
TyrKc 564 815 6.69e-148 SMART
Meta Mutation Damage Score 0.1624 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 91.7%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the FPS/FES family of non-transmembrane receptor tyrosine kinases. It regulates cell-cell adhesion and mediates signaling from the cell surface to the cytoskeleton via growth factor receptors. Alternative splicing results in multiple transcript variants. A related pseudogene has been identified on chromosome X. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygotes for a targeted mutation exhibit elevated lipopolysaccharide-induced leukocyte adhesion and migration. Mutant cells also exhibit reduced phosphorylation of cortactin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam8 T A 7: 139,986,812 probably benign Het
Akr1b8 T C 6: 34,364,330 probably benign Het
Arhgef39 A G 4: 43,498,613 L117P probably damaging Het
Atp13a1 A T 8: 69,797,324 Q356L possibly damaging Het
Bmp2k T A 5: 97,031,125 probably benign Het
Ccdc141 A G 2: 77,027,648 V1063A probably damaging Het
Col20a1 T C 2: 180,999,162 Y568H probably benign Het
Crabp2 T C 3: 87,953,021 V134A possibly damaging Het
Cyp19a1 T C 9: 54,172,741 K265E probably benign Het
Cyp2j9 T C 4: 96,585,885 H106R probably benign Het
Dcps T C 9: 35,175,943 K9R probably damaging Het
Dnajc6 C T 4: 101,598,956 T47I probably damaging Het
Dnhd1 T G 7: 105,720,114 S4315A possibly damaging Het
Dnmt3l A T 10: 78,052,737 I158F possibly damaging Het
Dock3 A G 9: 106,901,895 probably benign Het
Eefsec A G 6: 88,281,650 probably null Het
Fam204a T C 19: 60,221,296 M1V probably null Het
Fam98b T C 2: 117,267,847 V266A possibly damaging Het
Fat2 A T 11: 55,269,465 I3274N possibly damaging Het
Fbxo18 A G 2: 11,749,578 I198T probably damaging Het
Fhad1 T A 4: 142,002,426 M89L probably benign Het
Fjx1 C A 2: 102,451,107 C161F probably damaging Het
Fkbp7 T A 2: 76,665,824 probably benign Het
Gm42669 T A 5: 107,508,798 C976S probably benign Het
Gm4845 T C 1: 141,257,085 noncoding transcript Het
Herc1 T A 9: 66,481,050 probably benign Het
Hook3 C T 8: 26,044,235 probably null Het
Idh2 C T 7: 80,098,257 A232T probably damaging Het
Itga2b A T 11: 102,465,362 probably null Het
Klk1b21 T C 7: 44,105,493 Y71H probably benign Het
Kndc1 A T 7: 139,910,599 N339I possibly damaging Het
Ky C T 9: 102,542,090 T432I probably benign Het
Map4 C T 9: 110,034,628 T307I probably damaging Het
Matn1 T C 4: 130,944,476 L18P probably benign Het
Mindy4 G A 6: 55,216,684 D121N probably damaging Het
Mpv17l A T 16: 13,940,999 I96L probably benign Het
Msto1 G A 3: 88,910,339 Q441* probably null Het
Muc5ac A G 7: 141,812,251 H2048R possibly damaging Het
Musk T C 4: 58,373,711 *879Q probably null Het
Nat8f2 T C 6: 85,868,368 Y4C possibly damaging Het
Ncaph2 T A 15: 89,369,391 I282N probably benign Het
Nid1 A G 13: 13,463,836 T114A probably benign Het
Npr1 C A 3: 90,465,167 G113C probably damaging Het
Nrxn1 G A 17: 90,208,347 P193S probably damaging Het
Nwd2 T C 5: 63,805,682 F870L probably benign Het
Olfr1076 T A 2: 86,509,383 I308K possibly damaging Het
Olfr1228 A G 2: 89,249,070 I208T possibly damaging Het
Olfr55 A G 17: 33,176,548 I45V probably damaging Het
Olfr787 T A 10: 129,463,040 Y121* probably null Het
Phf14 A G 6: 11,997,020 probably benign Het
Pnpla5 G T 15: 84,120,719 L144M probably damaging Het
Prdm2 T C 4: 143,135,688 E344G probably benign Het
Psmd12 T C 11: 107,485,721 V61A probably benign Het
Relt T C 7: 100,847,505 D385G probably benign Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Scg2 T A 1: 79,435,549 I446F probably benign Het
Sema3b G A 9: 107,600,966 L407F probably damaging Het
Slc25a13 A T 6: 6,042,600 Y601* probably null Het
Sun5 C T 2: 153,858,965 V270I probably benign Het
Tex52 A G 6: 128,379,533 Y63C probably damaging Het
Tmem138 A G 19: 10,574,822 probably benign Het
Tnpo3 A G 6: 29,582,164 probably null Het
Tspoap1 A T 11: 87,766,454 Q364L probably damaging Het
Ttc41 T C 10: 86,763,947 L1037P probably damaging Het
Ugcg T A 4: 59,220,387 D393E possibly damaging Het
Vmn1r184 T C 7: 26,267,651 I274T probably benign Het
Vmn2r27 A G 6: 124,223,912 V362A probably benign Het
Vmn2r87 T A 10: 130,471,843 Y842F probably benign Het
Vps8 T A 16: 21,506,825 probably benign Het
Other mutations in Fer
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01625:Fer APN 17 64037626 missense probably damaging 1.00
IGL02004:Fer APN 17 63924179 critical splice donor site probably null
IGL02103:Fer APN 17 64138928 missense probably benign 0.02
IGL02157:Fer APN 17 64138899 missense probably benign 0.03
IGL02217:Fer APN 17 64138965 missense probably benign 0.00
IGL02376:Fer APN 17 63934346 missense possibly damaging 0.69
IGL02955:Fer APN 17 63991717 critical splice donor site probably null
IGL02967:Fer APN 17 63896267 missense possibly damaging 0.69
IGL03392:Fer APN 17 63991642 missense probably damaging 0.97
R0095:Fer UTSW 17 63941326 missense possibly damaging 0.51
R0095:Fer UTSW 17 63941326 missense possibly damaging 0.51
R0207:Fer UTSW 17 63896278 missense probably damaging 1.00
R0243:Fer UTSW 17 64078946 missense probably benign 0.00
R0309:Fer UTSW 17 64139016 makesense probably null
R0634:Fer UTSW 17 64035508 missense probably benign 0.40
R1885:Fer UTSW 17 64138914 missense probably damaging 0.96
R1939:Fer UTSW 17 63973128 missense probably damaging 1.00
R2427:Fer UTSW 17 63957303 missense probably benign
R2504:Fer UTSW 17 63991580 splice site probably null
R4301:Fer UTSW 17 64078910 missense probably damaging 1.00
R4404:Fer UTSW 17 63941289 critical splice acceptor site probably null
R4418:Fer UTSW 17 64029291 missense possibly damaging 0.89
R4812:Fer UTSW 17 63934297 missense probably benign
R5561:Fer UTSW 17 64037585 nonsense probably null
R5724:Fer UTSW 17 63924157 missense probably damaging 1.00
R5936:Fer UTSW 17 63924063 missense probably benign
R6157:Fer UTSW 17 64078885 missense probably damaging 1.00
R6848:Fer UTSW 17 63991606 missense probably damaging 1.00
R7175:Fer UTSW 17 63924095 missense probably benign 0.01
R7198:Fer UTSW 17 63921688 missense possibly damaging 0.84
R7438:Fer UTSW 17 64133521 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- GCCTTTGGTATGCACTGCGATAGAT -3'
(R):5'- GCCATGATAGCAATGACTCCTACCTCTC -3'

Sequencing Primer
(F):5'- CAGCTGCTAAAGAACAAGAAATCGA -3'
(R):5'- agttccatcacaagcaccc -3'
Posted On2013-04-24