Incidental Mutation 'R0385:Fmo1'
ID31201
Institutional Source Beutler Lab
Gene Symbol Fmo1
Ensembl Gene ENSMUSG00000040181
Gene Nameflavin containing monooxygenase 1
Synonyms
MMRRC Submission 038591-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R0385 (G1)
Quality Score222
Status Not validated
Chromosome1
Chromosomal Location162829561-162866610 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 162836204 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 252 (V252E)
Ref Sequence ENSEMBL: ENSMUSP00000117398 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046049] [ENSMUST00000111518] [ENSMUST00000131058] [ENSMUST00000134098] [ENSMUST00000193078]
Predicted Effect possibly damaging
Transcript: ENSMUST00000046049
AA Change: V252E

PolyPhen 2 Score 0.752 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000037259
Gene: ENSMUSG00000040181
AA Change: V252E

DomainStartEndE-ValueType
Pfam:FMO-like 2 532 1.5e-279 PFAM
Pfam:Pyr_redox_2 3 228 3.8e-13 PFAM
Pfam:NAD_binding_8 7 63 8e-7 PFAM
Pfam:K_oxygenase 73 226 3.4e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111518
SMART Domains Protein: ENSMUSP00000107143
Gene: ENSMUSG00000040181

DomainStartEndE-ValueType
Pfam:FMO-like 2 170 4.6e-93 PFAM
Pfam:Pyr_redox_3 6 173 2.7e-8 PFAM
Pfam:NAD_binding_8 7 65 5.5e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131058
SMART Domains Protein: ENSMUSP00000118534
Gene: ENSMUSG00000040181

DomainStartEndE-ValueType
Pfam:FMO-like 2 209 9.3e-122 PFAM
Pfam:Pyr_redox_2 4 208 8.2e-9 PFAM
Pfam:Pyr_redox_3 6 209 7.5e-16 PFAM
Pfam:NAD_binding_8 7 65 5.2e-8 PFAM
Pfam:K_oxygenase 72 209 1.4e-10 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000134098
AA Change: V252E

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000117398
Gene: ENSMUSG00000040181
AA Change: V252E

DomainStartEndE-ValueType
Pfam:FMO-like 2 303 1.4e-168 PFAM
Pfam:Pyr_redox_2 4 280 8e-9 PFAM
Pfam:Pyr_redox_3 6 220 5.5e-16 PFAM
Pfam:NAD_binding_8 7 65 9.5e-8 PFAM
Pfam:K_oxygenase 72 224 2.1e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143902
Predicted Effect probably benign
Transcript: ENSMUST00000193078
SMART Domains Protein: ENSMUSP00000141210
Gene: ENSMUSG00000040181

DomainStartEndE-ValueType
Pfam:FMO-like 2 230 9.4e-132 PFAM
Pfam:Pyr_redox_2 4 223 4.9e-7 PFAM
Pfam:Pyr_redox_3 6 220 3.1e-14 PFAM
Pfam:NAD_binding_8 7 65 6.9e-6 PFAM
Pfam:K_oxygenase 72 222 3.8e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193766
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Metabolic N-oxidation of the diet-derived amino-trimethylamine (TMA) is mediated by flavin-containing monooxygenase and is subject to an inherited FMO3 polymorphism in man resulting in a small subpopulation with reduced TMA N-oxidation capacity resulting in fish odor syndrome Trimethylaminuria. Three forms of the enzyme, FMO1 found in fetal liver, FMO2 found in adult liver, and FMO3 are encoded by genes clustered in the 1q23-q25 region. Flavin-containing monooxygenases are NADPH-dependent flavoenzymes that catalyzes the oxidation of soft nucleophilic heteroatom centers in drugs, pesticides, and xenobiotics. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2013]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca A G 11: 84,231,748 N331S probably benign Het
Adk A G 14: 21,318,074 N189S probably benign Het
Apc T A 18: 34,315,944 N1930K probably damaging Het
Arhgap28 T C 17: 67,864,606 D391G probably damaging Het
Atn1 G T 6: 124,743,371 probably benign Het
C2cd5 T C 6: 143,041,490 E471G probably damaging Het
Camta1 C A 4: 151,075,140 R1614L probably damaging Het
Cap2 T C 13: 46,560,547 L34P probably damaging Het
Cdc42ep2 T A 19: 5,918,525 M51L probably benign Het
Cntn5 C T 9: 9,972,870 A254T probably damaging Het
Dicer1 A T 12: 104,704,174 L1044H probably damaging Het
Dkk3 A C 7: 112,158,223 M58R probably damaging Het
Dpy19l3 G A 7: 35,752,705 R5W probably damaging Het
Dsg1c C T 18: 20,283,654 P871S probably damaging Het
Dusp1 A T 17: 26,507,696 S131T probably benign Het
Enpp2 C T 15: 54,882,159 G314R probably damaging Het
Fam222b C A 11: 78,154,930 P439Q probably benign Het
Fastkd2 A T 1: 63,737,811 I369F probably benign Het
Fdps G A 3: 89,094,894 S205F probably damaging Het
Frmd5 A G 2: 121,555,574 Y230H probably damaging Het
Gal C T 19: 3,411,171 V88I probably benign Het
Gm38394 A T 1: 133,656,784 D938E probably damaging Het
Gnptab T C 10: 88,436,525 I1009T probably damaging Het
Idh2 C T 7: 80,098,257 A232T probably damaging Het
Klhdc7a A T 4: 139,966,705 D310E probably benign Het
Klk4 T C 7: 43,884,008 M97T probably benign Het
Krt82 C T 15: 101,545,593 V227M probably damaging Het
Lpp T C 16: 24,761,837 V226A probably damaging Het
Mbd1 AGCTGACTCGGTAC A 18: 74,273,241 probably null Het
Mcm10 T C 2: 5,004,154 K335E possibly damaging Het
Mpv17l A T 16: 13,940,999 I96L probably benign Het
Muc6 G A 7: 141,638,400 S2120F possibly damaging Het
Myb T C 10: 21,154,712 D62G possibly damaging Het
Nasp A T 4: 116,610,695 N364K probably benign Het
Npsr1 A G 9: 24,313,277 N317D probably damaging Het
Nup210 A G 6: 91,028,795 V619A possibly damaging Het
Oser1 C T 2: 163,411,396 probably null Het
Pcdhb4 T C 18: 37,309,215 F526S probably damaging Het
Plekhh3 T C 11: 101,165,141 N444S probably damaging Het
Pnpla5 G T 15: 84,120,719 L144M probably damaging Het
Pou2f2 G A 7: 25,116,076 Q89* probably null Het
Ptprb A G 10: 116,350,178 I1713V probably benign Het
Ptprd A G 4: 76,128,665 Y442H probably damaging Het
Rad21 A T 15: 51,973,863 I152N possibly damaging Het
Ralgapa1 A G 12: 55,677,038 S1568P probably damaging Het
Rhag T A 17: 40,834,727 V357E probably damaging Het
Rnf121 A T 7: 102,029,117 D174E possibly damaging Het
Sdccag3 T C 2: 26,387,659 E41G possibly damaging Het
Sf3b4 T C 3: 96,172,982 Y16H probably damaging Het
Slc1a3 C T 15: 8,639,135 V449I probably damaging Het
Slc20a2 A G 8: 22,568,393 I648M probably benign Het
Slc25a25 T A 2: 32,417,822 I254F probably damaging Het
Slit3 A G 11: 35,700,282 H1307R probably damaging Het
Sorl1 C A 9: 42,031,909 M890I probably damaging Het
Supt16 A C 14: 52,176,718 M468R probably benign Het
Taf4b T C 18: 14,783,760 S56P probably benign Het
Tapt1 T C 5: 44,218,101 probably null Het
Tmco3 T G 8: 13,296,027 C288W probably damaging Het
Tpcn2 A G 7: 145,277,174 Y145H probably damaging Het
Ttn C T 2: 76,881,717 probably benign Het
Usb1 G T 8: 95,345,318 W215C probably damaging Het
Usp2 C G 9: 44,092,750 T305R probably damaging Het
Vmn1r13 G A 6: 57,210,705 S283N probably benign Het
Vps54 A G 11: 21,306,381 K467E possibly damaging Het
Wnk2 G T 13: 49,068,128 S1121Y probably damaging Het
Other mutations in Fmo1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Fmo1 APN 1 162836246 missense probably damaging 1.00
IGL00479:Fmo1 APN 1 162830063 missense probably benign 0.00
IGL01612:Fmo1 APN 1 162833599 missense probably benign 0.42
IGL01650:Fmo1 APN 1 162833584 missense probably benign 0.04
IGL02052:Fmo1 APN 1 162850060 critical splice donor site probably null
IGL02340:Fmo1 APN 1 162832990 missense probably benign 0.02
IGL03348:Fmo1 APN 1 162850151 missense possibly damaging 0.76
IGL03388:Fmo1 APN 1 162836147 missense probably benign 0.17
PIT1430001:Fmo1 UTSW 1 162830053 missense probably benign 0.00
R0279:Fmo1 UTSW 1 162830272 missense possibly damaging 0.92
R0314:Fmo1 UTSW 1 162859462 missense probably damaging 1.00
R0348:Fmo1 UTSW 1 162836135 missense probably benign 0.35
R0699:Fmo1 UTSW 1 162833772 missense probably benign 0.00
R1413:Fmo1 UTSW 1 162833862 missense probably damaging 0.98
R1424:Fmo1 UTSW 1 162830066 missense probably damaging 1.00
R1430:Fmo1 UTSW 1 162839724 missense probably damaging 1.00
R1851:Fmo1 UTSW 1 162829985 nonsense probably null
R1929:Fmo1 UTSW 1 162833855 missense probably damaging 1.00
R1982:Fmo1 UTSW 1 162839756 missense possibly damaging 0.83
R2272:Fmo1 UTSW 1 162833855 missense probably damaging 1.00
R2568:Fmo1 UTSW 1 162836259 missense probably benign 0.00
R3787:Fmo1 UTSW 1 162830014 missense possibly damaging 0.54
R3825:Fmo1 UTSW 1 162851347 splice site probably benign
R3904:Fmo1 UTSW 1 162833768 missense possibly damaging 0.54
R4320:Fmo1 UTSW 1 162833631 missense probably damaging 1.00
R4367:Fmo1 UTSW 1 162833648 nonsense probably null
R4431:Fmo1 UTSW 1 162833712 missense possibly damaging 0.76
R4473:Fmo1 UTSW 1 162850163 missense possibly damaging 0.90
R5340:Fmo1 UTSW 1 162829982 missense probably benign 0.39
R5354:Fmo1 UTSW 1 162830145 missense probably benign 0.01
R5479:Fmo1 UTSW 1 162850224 missense probably damaging 0.99
R5930:Fmo1 UTSW 1 162839616 critical splice donor site probably null
R6148:Fmo1 UTSW 1 162851519 missense probably damaging 0.99
R6160:Fmo1 UTSW 1 162836298 missense probably benign 0.00
R6164:Fmo1 UTSW 1 162851410 missense probably benign 0.24
R6263:Fmo1 UTSW 1 162850060 critical splice donor site probably null
R7046:Fmo1 UTSW 1 162839694 missense possibly damaging 0.92
X0022:Fmo1 UTSW 1 162830000 missense possibly damaging 0.57
X0066:Fmo1 UTSW 1 162839704 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCAAAGTGAAATACCTGTCAACTGAGC -3'
(R):5'- TGCCCTCTCACATGAGACTTAGAGC -3'

Sequencing Primer
(F):5'- ATACCTGTCAACTGAGCACTTG -3'
(R):5'- ATCAAGGCTATCATGTCAGGTG -3'
Posted On2013-04-24