Incidental Mutation 'R3960:Sec23ip'
ID312056
Institutional Source Beutler Lab
Gene Symbol Sec23ip
Ensembl Gene ENSMUSG00000055319
Gene NameSec23 interacting protein
SynonymsD7Ertd373e, p125
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.583) question?
Stock #R3960 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location128744943-128784836 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 128776850 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 796 (T796S)
Ref Sequence ENSEMBL: ENSMUSP00000035610 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042942]
Predicted Effect probably benign
Transcript: ENSMUST00000042942
AA Change: T796S

PolyPhen 2 Score 0.350 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000035610
Gene: ENSMUSG00000055319
AA Change: T796S

DomainStartEndE-ValueType
low complexity region 8 26 N/A INTRINSIC
low complexity region 41 51 N/A INTRINSIC
low complexity region 79 88 N/A INTRINSIC
low complexity region 203 215 N/A INTRINSIC
low complexity region 222 230 N/A INTRINSIC
Blast:DDHD 513 585 8e-33 BLAST
SAM 637 702 2.18e-9 SMART
DDHD 777 987 1.33e-74 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104095
Meta Mutation Damage Score 0.252 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the phosphatidic acid preferring-phospholipase A1 family. The encoded protein is localized to endoplasmic reticulum exit sites and plays a critical role in ER-Golgi transport as part of the multimeric coat protein II complex. An orthologous gene in frogs is required for normal neural crest cell development, suggesting that this gene may play a role in Waardenburg syndrome neural crest defects. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Male mice homozygous for a null allele display reduced fertility with globozoospermia and impaired fertilization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Celf4 A G 18: 25,537,754 M124T probably benign Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Etl4 A G 2: 20,340,043 T53A probably benign Het
Hao1 A C 2: 134,522,983 probably null Het
Hmgcs2 T C 3: 98,297,477 F317S possibly damaging Het
Ildr2 T A 1: 166,309,340 W564R probably damaging Het
Impg1 G T 9: 80,440,864 F29L probably benign Het
Itgam T C 7: 128,115,175 V834A probably benign Het
Itpr2 T C 6: 146,229,764 N1948D probably damaging Het
Itpr2 C T 6: 146,425,510 V120I probably damaging Het
Katnb1 T C 8: 95,087,297 V17A possibly damaging Het
Nipbl T C 15: 8,350,534 N925D probably benign Het
Oasl2 T C 5: 114,905,037 V70A probably benign Het
Panx1 GTTCTTCT GTTCT 9: 15,006,171 probably benign Het
Pcdh10 A G 3: 45,379,314 H21R probably benign Het
Prkg2 G T 5: 98,997,495 T160K possibly damaging Het
Smarcd2 A G 11: 106,266,575 S182P probably damaging Het
Tbrg4 A G 11: 6,618,077 S484P probably benign Het
Tprkb A G 6: 85,928,801 E156G probably benign Het
Zfp647 A G 15: 76,910,976 probably null Het
Other mutations in Sec23ip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00825:Sec23ip APN 7 128767609 missense probably damaging 1.00
IGL01347:Sec23ip APN 7 128762405 missense probably benign 0.08
IGL01358:Sec23ip APN 7 128752797 missense possibly damaging 0.68
IGL01656:Sec23ip APN 7 128750245 missense probably damaging 1.00
IGL01835:Sec23ip APN 7 128755311 splice site probably null
IGL02233:Sec23ip APN 7 128779179 missense probably damaging 1.00
IGL02499:Sec23ip APN 7 128776916 missense probably damaging 1.00
IGL03381:Sec23ip APN 7 128750305 missense probably damaging 0.97
R0053:Sec23ip UTSW 7 128745167 missense probably damaging 1.00
R0147:Sec23ip UTSW 7 128779051 splice site probably benign
R0360:Sec23ip UTSW 7 128761405 splice site probably benign
R1427:Sec23ip UTSW 7 128776885 missense probably damaging 0.99
R1442:Sec23ip UTSW 7 128776786 missense probably benign 0.10
R1462:Sec23ip UTSW 7 128766138 missense probably benign
R1462:Sec23ip UTSW 7 128766138 missense probably benign
R1564:Sec23ip UTSW 7 128766281 splice site probably null
R1876:Sec23ip UTSW 7 128752851 missense probably benign
R1966:Sec23ip UTSW 7 128755353 missense probably damaging 0.98
R1977:Sec23ip UTSW 7 128766273 missense probably damaging 1.00
R2115:Sec23ip UTSW 7 128762461 missense probably benign 0.00
R2847:Sec23ip UTSW 7 128754073 missense probably benign 0.00
R3958:Sec23ip UTSW 7 128776850 missense probably benign 0.35
R3959:Sec23ip UTSW 7 128776850 missense probably benign 0.35
R4287:Sec23ip UTSW 7 128777333 missense probably benign 0.37
R4510:Sec23ip UTSW 7 128779176 missense probably damaging 1.00
R4511:Sec23ip UTSW 7 128779176 missense probably damaging 1.00
R4612:Sec23ip UTSW 7 128750502 nonsense probably null
R4660:Sec23ip UTSW 7 128750286 missense probably null 0.00
R4890:Sec23ip UTSW 7 128752910 missense probably damaging 0.98
R5287:Sec23ip UTSW 7 128766136 missense probably benign
R5587:Sec23ip UTSW 7 128750427 missense probably benign
R5625:Sec23ip UTSW 7 128744983 unclassified probably benign
R5656:Sec23ip UTSW 7 128776784 missense probably damaging 1.00
R5808:Sec23ip UTSW 7 128772184 missense probably benign 0.00
R6034:Sec23ip UTSW 7 128750203 missense possibly damaging 0.66
R6034:Sec23ip UTSW 7 128750203 missense possibly damaging 0.66
R6145:Sec23ip UTSW 7 128778484 missense probably damaging 0.99
R6747:Sec23ip UTSW 7 128752849 synonymous silent
R6953:Sec23ip UTSW 7 128752796 nonsense probably null
R6992:Sec23ip UTSW 7 128765440 missense probably benign
R7131:Sec23ip UTSW 7 128779640 missense probably damaging 1.00
R7163:Sec23ip UTSW 7 128762533 critical splice donor site probably null
R7387:Sec23ip UTSW 7 128745003 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- AATGGGCCATGCTTACCTTC -3'
(R):5'- GAGCTTTGCAAATCATGACTGC -3'

Sequencing Primer
(F):5'- AGAGGCCTCCGTGTTTGC -3'
(R):5'- ACAGTAACTCACCGGATG -3'
Posted On2015-04-29