Incidental Mutation 'R3960:Sec23ip'
ID 312056
Institutional Source Beutler Lab
Gene Symbol Sec23ip
Ensembl Gene ENSMUSG00000055319
Gene Name Sec23 interacting protein
Synonyms p125, D7Ertd373e
Accession Numbers
Essential gene? Possibly essential (E-score: 0.583) question?
Stock # R3960 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 128346667-128386560 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to G at 128378574 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 796 (T796S)
Ref Sequence ENSEMBL: ENSMUSP00000035610 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042942]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000042942
AA Change: T796S

PolyPhen 2 Score 0.350 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000035610
Gene: ENSMUSG00000055319
AA Change: T796S

DomainStartEndE-ValueType
low complexity region 8 26 N/A INTRINSIC
low complexity region 41 51 N/A INTRINSIC
low complexity region 79 88 N/A INTRINSIC
low complexity region 203 215 N/A INTRINSIC
low complexity region 222 230 N/A INTRINSIC
Blast:DDHD 513 585 8e-33 BLAST
SAM 637 702 2.18e-9 SMART
DDHD 777 987 1.33e-74 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104095
Meta Mutation Damage Score 0.5043 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the phosphatidic acid preferring-phospholipase A1 family. The encoded protein is localized to endoplasmic reticulum exit sites and plays a critical role in ER-Golgi transport as part of the multimeric coat protein II complex. An orthologous gene in frogs is required for normal neural crest cell development, suggesting that this gene may play a role in Waardenburg syndrome neural crest defects. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Male mice homozygous for a null allele display reduced fertility with globozoospermia and impaired fertilization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,211,320 (GRCm39) E685* probably null Het
2700049A03Rik A T 12: 71,211,321 (GRCm39) E685V possibly damaging Het
Celf4 A G 18: 25,670,811 (GRCm39) M124T probably benign Het
Espl1 A G 15: 102,221,424 (GRCm39) I944V probably damaging Het
Etl4 A G 2: 20,344,854 (GRCm39) T53A probably benign Het
Hao1 A C 2: 134,364,903 (GRCm39) probably null Het
Hmgcs2 T C 3: 98,204,793 (GRCm39) F317S possibly damaging Het
Ildr2 T A 1: 166,136,909 (GRCm39) W564R probably damaging Het
Impg1 G T 9: 80,322,917 (GRCm39) F29L probably benign Het
Itgam T C 7: 127,714,347 (GRCm39) V834A probably benign Het
Itpr2 C T 6: 146,327,008 (GRCm39) V120I probably damaging Het
Itpr2 T C 6: 146,131,262 (GRCm39) N1948D probably damaging Het
Katnb1 T C 8: 95,813,925 (GRCm39) V17A possibly damaging Het
Nipbl T C 15: 8,380,018 (GRCm39) N925D probably benign Het
Oasl2 T C 5: 115,043,098 (GRCm39) V70A probably benign Het
Panx1 GTTCTTCT GTTCT 9: 14,917,467 (GRCm39) probably benign Het
Pcdh10 A G 3: 45,333,749 (GRCm39) H21R probably benign Het
Prkg2 G T 5: 99,145,354 (GRCm39) T160K possibly damaging Het
Smarcd2 A G 11: 106,157,401 (GRCm39) S182P probably damaging Het
Tbrg4 A G 11: 6,568,077 (GRCm39) S484P probably benign Het
Tprkb A G 6: 85,905,783 (GRCm39) E156G probably benign Het
Zfp647 A G 15: 76,795,176 (GRCm39) probably null Het
Other mutations in Sec23ip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00825:Sec23ip APN 7 128,369,333 (GRCm39) missense probably damaging 1.00
IGL01347:Sec23ip APN 7 128,364,129 (GRCm39) missense probably benign 0.08
IGL01358:Sec23ip APN 7 128,354,521 (GRCm39) missense possibly damaging 0.68
IGL01656:Sec23ip APN 7 128,351,969 (GRCm39) missense probably damaging 1.00
IGL01835:Sec23ip APN 7 128,357,035 (GRCm39) splice site probably null
IGL02233:Sec23ip APN 7 128,380,903 (GRCm39) missense probably damaging 1.00
IGL02499:Sec23ip APN 7 128,378,640 (GRCm39) missense probably damaging 1.00
IGL03381:Sec23ip APN 7 128,352,029 (GRCm39) missense probably damaging 0.97
R0053:Sec23ip UTSW 7 128,346,891 (GRCm39) missense probably damaging 1.00
R0147:Sec23ip UTSW 7 128,380,775 (GRCm39) splice site probably benign
R0360:Sec23ip UTSW 7 128,363,129 (GRCm39) splice site probably benign
R1427:Sec23ip UTSW 7 128,378,609 (GRCm39) missense probably damaging 0.99
R1442:Sec23ip UTSW 7 128,378,510 (GRCm39) missense probably benign 0.10
R1462:Sec23ip UTSW 7 128,367,862 (GRCm39) missense probably benign
R1462:Sec23ip UTSW 7 128,367,862 (GRCm39) missense probably benign
R1564:Sec23ip UTSW 7 128,368,005 (GRCm39) splice site probably null
R1876:Sec23ip UTSW 7 128,354,575 (GRCm39) missense probably benign
R1966:Sec23ip UTSW 7 128,357,077 (GRCm39) missense probably damaging 0.98
R1977:Sec23ip UTSW 7 128,367,997 (GRCm39) missense probably damaging 1.00
R2115:Sec23ip UTSW 7 128,364,185 (GRCm39) missense probably benign 0.00
R2847:Sec23ip UTSW 7 128,355,797 (GRCm39) missense probably benign 0.00
R3958:Sec23ip UTSW 7 128,378,574 (GRCm39) missense probably benign 0.35
R3959:Sec23ip UTSW 7 128,378,574 (GRCm39) missense probably benign 0.35
R4287:Sec23ip UTSW 7 128,379,057 (GRCm39) missense probably benign 0.37
R4510:Sec23ip UTSW 7 128,380,900 (GRCm39) missense probably damaging 1.00
R4511:Sec23ip UTSW 7 128,380,900 (GRCm39) missense probably damaging 1.00
R4612:Sec23ip UTSW 7 128,352,226 (GRCm39) nonsense probably null
R4660:Sec23ip UTSW 7 128,352,010 (GRCm39) missense probably null 0.00
R4890:Sec23ip UTSW 7 128,354,634 (GRCm39) missense probably damaging 0.98
R5287:Sec23ip UTSW 7 128,367,860 (GRCm39) missense probably benign
R5587:Sec23ip UTSW 7 128,352,151 (GRCm39) missense probably benign
R5625:Sec23ip UTSW 7 128,346,707 (GRCm39) unclassified probably benign
R5656:Sec23ip UTSW 7 128,378,508 (GRCm39) missense probably damaging 1.00
R5808:Sec23ip UTSW 7 128,373,908 (GRCm39) missense probably benign 0.00
R6034:Sec23ip UTSW 7 128,351,927 (GRCm39) missense possibly damaging 0.66
R6034:Sec23ip UTSW 7 128,351,927 (GRCm39) missense possibly damaging 0.66
R6145:Sec23ip UTSW 7 128,380,208 (GRCm39) missense probably damaging 0.99
R6747:Sec23ip UTSW 7 128,354,573 (GRCm39) synonymous silent
R6953:Sec23ip UTSW 7 128,354,520 (GRCm39) nonsense probably null
R6992:Sec23ip UTSW 7 128,367,164 (GRCm39) missense probably benign
R7131:Sec23ip UTSW 7 128,381,364 (GRCm39) missense probably damaging 1.00
R7163:Sec23ip UTSW 7 128,364,257 (GRCm39) critical splice donor site probably null
R7387:Sec23ip UTSW 7 128,346,727 (GRCm39) unclassified probably benign
R7559:Sec23ip UTSW 7 128,379,074 (GRCm39) missense possibly damaging 0.65
R7975:Sec23ip UTSW 7 128,364,201 (GRCm39) missense probably damaging 1.00
R8158:Sec23ip UTSW 7 128,369,364 (GRCm39) missense probably damaging 0.99
R8337:Sec23ip UTSW 7 128,365,749 (GRCm39) missense probably damaging 1.00
R8409:Sec23ip UTSW 7 128,365,855 (GRCm39) missense probably damaging 1.00
R8418:Sec23ip UTSW 7 128,380,187 (GRCm39) missense probably damaging 0.98
R8434:Sec23ip UTSW 7 128,352,151 (GRCm39) missense probably benign
R8461:Sec23ip UTSW 7 128,373,926 (GRCm39) missense probably benign
R8553:Sec23ip UTSW 7 128,355,777 (GRCm39) missense probably damaging 1.00
R8897:Sec23ip UTSW 7 128,354,467 (GRCm39) missense probably benign 0.14
R9059:Sec23ip UTSW 7 128,365,805 (GRCm39) missense probably damaging 1.00
R9142:Sec23ip UTSW 7 128,363,226 (GRCm39) missense probably damaging 1.00
R9674:Sec23ip UTSW 7 128,380,187 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AATGGGCCATGCTTACCTTC -3'
(R):5'- GAGCTTTGCAAATCATGACTGC -3'

Sequencing Primer
(F):5'- AGAGGCCTCCGTGTTTGC -3'
(R):5'- ACAGTAACTCACCGGATG -3'
Posted On 2015-04-29