Incidental Mutation 'R3961:Tpte'
ID312085
Institutional Source Beutler Lab
Gene Symbol Tpte
Ensembl Gene ENSMUSG00000031481
Gene Nametransmembrane phosphatase with tensin homology
SynonymsPten2
MMRRC Submission 040836-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #R3961 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location22283441-22371418 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 22359415 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 553 (S553G)
Ref Sequence ENSEMBL: ENSMUSP00000076435 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077194] [ENSMUST00000211497] [ENSMUST00000211747]
Predicted Effect probably damaging
Transcript: ENSMUST00000077194
AA Change: S553G

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000076435
Gene: ENSMUSG00000031481
AA Change: S553G

DomainStartEndE-ValueType
low complexity region 146 167 N/A INTRINSIC
transmembrane domain 212 231 N/A INTRINSIC
transmembrane domain 246 265 N/A INTRINSIC
transmembrane domain 277 299 N/A INTRINSIC
low complexity region 307 329 N/A INTRINSIC
Pfam:Y_phosphatase 369 511 1.4e-6 PFAM
Pfam:DSPc 384 505 7.3e-8 PFAM
PTEN_C2 529 663 3.72e-43 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000211497
Predicted Effect possibly damaging
Transcript: ENSMUST00000211747
AA Change: S553G

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] TPIP is a member of a large class of membrane-associated phosphatases with substrate specificity for the 3-position phosphate of inositol phospholipids.[supplied by OMIM, Jul 2002]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik1 T C 11: 48,947,976 T595A possibly damaging Het
AF529169 G A 9: 89,601,910 T478I probably damaging Het
Bicral T C 17: 46,824,825 I486M probably damaging Het
Btbd1 C A 7: 81,818,335 E146* probably null Het
Cdcp1 T C 9: 123,182,381 T344A possibly damaging Het
Cenpm A T 15: 82,234,373 L180Q possibly damaging Het
Cers3 G T 7: 66,786,075 A261S probably benign Het
Dazl A G 17: 50,288,133 V91A probably damaging Het
Dsc2 C T 18: 20,051,227 V35I probably damaging Het
Fras1 T C 5: 96,677,385 probably null Het
Ltbp3 G A 19: 5,754,022 R854Q probably benign Het
Mme T A 3: 63,345,192 M419K probably damaging Het
Ncan G A 8: 70,110,300 T436M probably benign Het
Nphp3 G T 9: 104,003,042 E88* probably null Het
Olfr993 T C 2: 85,414,872 I2M possibly damaging Het
Pdcl T C 2: 37,352,187 M184V probably benign Het
Polr3b T C 10: 84,684,302 M694T possibly damaging Het
Pramef8 T A 4: 143,419,318 N452K probably benign Het
Prkdc T G 16: 15,829,611 probably null Het
Prss35 A G 9: 86,755,749 M191V probably benign Het
Rtn3 T C 19: 7,458,145 S142G probably damaging Het
Slc19a3 A T 1: 83,022,957 F113Y probably damaging Het
Taf7 A G 18: 37,643,121 V131A probably benign Het
Tesk1 A G 4: 43,445,133 probably null Het
Tmem131 C T 1: 36,818,950 D741N probably damaging Het
Tmem63a G A 1: 180,963,114 D446N possibly damaging Het
Trpv3 A T 11: 73,287,420 K438* probably null Het
Vmn2r107 G A 17: 20,375,455 G757R probably damaging Het
Other mutations in Tpte
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01014:Tpte APN 8 22320882 missense probably benign 0.03
IGL01456:Tpte APN 8 22345052 splice site probably benign
IGL01947:Tpte APN 8 22355473 missense possibly damaging 0.88
IGL01975:Tpte APN 8 22349337 missense probably damaging 1.00
IGL02458:Tpte APN 8 22305858 missense probably benign
IGL03411:Tpte APN 8 22325537 missense possibly damaging 0.64
R0158:Tpte UTSW 8 22327739 missense possibly damaging 0.47
R0396:Tpte UTSW 8 22335608 splice site probably benign
R0611:Tpte UTSW 8 22336533 missense possibly damaging 0.68
R1481:Tpte UTSW 8 22355471 missense probably damaging 1.00
R1489:Tpte UTSW 8 22349389 critical splice donor site probably null
R1569:Tpte UTSW 8 22345031 missense probably damaging 0.98
R1632:Tpte UTSW 8 22349347 missense probably damaging 0.98
R1639:Tpte UTSW 8 22320897 missense probably benign 0.00
R2030:Tpte UTSW 8 22345885 missense probably damaging 1.00
R2057:Tpte UTSW 8 22318339 missense probably benign 0.13
R2519:Tpte UTSW 8 22333160 splice site probably benign
R2655:Tpte UTSW 8 22311278 critical splice acceptor site probably null
R2884:Tpte UTSW 8 22335423 nonsense probably null
R3033:Tpte UTSW 8 22320872 missense possibly damaging 0.84
R3734:Tpte UTSW 8 22359482 missense probably damaging 1.00
R4050:Tpte UTSW 8 22365984 missense probably damaging 1.00
R4591:Tpte UTSW 8 22327775 missense probably benign 0.08
R4994:Tpte UTSW 8 22318346 missense probably benign 0.23
R5321:Tpte UTSW 8 22297203 nonsense probably null
R5394:Tpte UTSW 8 22327790 missense probably damaging 1.00
R5588:Tpte UTSW 8 22284967 missense possibly damaging 0.95
R5590:Tpte UTSW 8 22351452 missense probably damaging 1.00
R5670:Tpte UTSW 8 22327748 missense probably damaging 1.00
R6544:Tpte UTSW 8 22315105 critical splice donor site probably null
R6596:Tpte UTSW 8 22333269 missense probably damaging 0.99
R6729:Tpte UTSW 8 22355475 missense probably damaging 1.00
R7120:Tpte UTSW 8 22327673 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCCGCAAAATCAAGCTTTTG -3'
(R):5'- CATCTCTTTGTGGCTTAGTGAAC -3'

Sequencing Primer
(F):5'- CCGCAAAATCAAGCTTTTGAAGTC -3'
(R):5'- ATTGACCAAGTGCCTATCGG -3'
Posted On2015-04-29