Incidental Mutation 'R3962:Ptpa'
ID312108
Institutional Source Beutler Lab
Gene Symbol Ptpa
Ensembl Gene ENSMUSG00000039515
Gene Nameprotein phosphatase 2 protein activator
SynonymsPpp2r4, 2610042B21Rik
MMRRC Submission 040837-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.903) question?
Stock #R3962 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location30416039-30447806 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 30435660 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 147 (T147A)
Ref Sequence ENSEMBL: ENSMUSP00000046837 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042055] [ENSMUST00000113601] [ENSMUST00000113603] [ENSMUST00000152165]
Predicted Effect probably damaging
Transcript: ENSMUST00000042055
AA Change: T147A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000046837
Gene: ENSMUSG00000039515
AA Change: T147A

DomainStartEndE-ValueType
low complexity region 8 20 N/A INTRINSIC
Pfam:PTPA 26 319 1.5e-126 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113601
SMART Domains Protein: ENSMUSP00000109231
Gene: ENSMUSG00000039515

DomainStartEndE-ValueType
low complexity region 8 20 N/A INTRINSIC
Pfam:PTPA 38 104 5.7e-28 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000113603
AA Change: T105A

PolyPhen 2 Score 0.912 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000109233
Gene: ENSMUSG00000039515
AA Change: T105A

DomainStartEndE-ValueType
low complexity region 8 20 N/A INTRINSIC
Pfam:PTPA 64 280 5.7e-90 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125561
SMART Domains Protein: ENSMUSP00000114290
Gene: ENSMUSG00000039515

DomainStartEndE-ValueType
Pfam:PTPA 1 125 6.1e-57 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125743
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128516
Predicted Effect probably benign
Transcript: ENSMUST00000152165
Meta Mutation Damage Score 0.448 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 93.9%
Validation Efficiency 96% (48/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Protein phosphatase 2A is one of the four major Ser/Thr phosphatases and is implicated in the negative control of cell growth and division. Protein phosphatase 2A holoenzymes are heterotrimeric proteins composed of a structural subunit A, a catalytic subunit C, and a regulatory subunit B. The regulatory subunit is encoded by a diverse set of genes that have been grouped into the B/PR55, B'/PR61, and B''/PR72 families. These different regulatory subunits confer distinct enzymatic specificities and intracellular localizations to the holozenzyme. The product of this gene belongs to the B' family. This gene encodes a specific phosphotyrosyl phosphatase activator of the dimeric form of protein phosphatase 2A. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019N19Rik A G 19: 58,789,109 Y82H probably damaging Het
9930111J21Rik1 T C 11: 48,947,976 T595A possibly damaging Het
Abca12 A T 1: 71,274,515 probably null Het
Ablim2 C T 5: 35,812,175 R211C probably damaging Het
Actn4 C A 7: 28,898,222 probably null Het
AF529169 G A 9: 89,601,910 T478I probably damaging Het
B3gnt5 A G 16: 19,769,048 S6G probably benign Het
Bod1l T G 5: 41,808,721 E2667A probably benign Het
Ccdc13 G A 9: 121,798,939 probably benign Het
Ccdc15 G T 9: 37,320,486 R181S probably damaging Het
Ccnd1 G A 7: 144,934,050 T230M probably damaging Het
Cdcp1 T C 9: 123,182,381 T344A possibly damaging Het
Fam161a T C 11: 23,023,507 M275T possibly damaging Het
Fbxo15 A G 18: 84,959,247 T95A probably benign Het
Fndc5 T C 4: 129,139,895 V152A probably benign Het
Galk2 A T 2: 125,893,373 N107I probably benign Het
Glmn A T 5: 107,561,045 probably benign Het
Gm5082 T C 13: 41,656,418 noncoding transcript Het
Gm5828 C T 1: 16,768,644 noncoding transcript Het
Haus6 C T 4: 86,611,804 A4T possibly damaging Het
Hmgcs2 G A 3: 98,291,038 V86M possibly damaging Het
Hrg G A 16: 22,956,075 V152I possibly damaging Het
Itga2 A T 13: 114,839,518 V1106E probably damaging Het
Itga9 G A 9: 118,628,186 D122N possibly damaging Het
Kif21a T A 15: 90,985,409 E413V probably damaging Het
Klk1 A G 7: 44,229,549 T256A possibly damaging Het
L1td1 T C 4: 98,737,449 V627A probably benign Het
Larp4 C A 15: 100,012,145 Q652K probably damaging Het
Ltbp3 G A 19: 5,754,022 R854Q probably benign Het
Moxd2 T A 6: 40,885,397 M163L probably benign Het
Myo15 G A 11: 60,479,828 R1138H probably benign Het
Oasl2 A G 5: 114,897,747 D28G probably benign Het
Olfr777 A T 10: 129,268,666 I219N probably damaging Het
Platr26 A T 2: 71,719,505 noncoding transcript Het
Ptdss1 A G 13: 66,994,011 H411R probably benign Het
Rfx2 T C 17: 56,785,302 Y307C probably damaging Het
Rtn3 T C 19: 7,458,145 S142G probably damaging Het
Shisa6 A G 11: 66,217,476 V525A probably damaging Het
Slc4a3 A G 1: 75,556,754 S1007G probably damaging Het
Srsf3 C T 17: 29,036,456 probably benign Het
Taar8a A G 10: 24,077,156 I219M probably damaging Het
Tars2 A G 3: 95,754,756 probably null Het
Tfap2d A G 1: 19,118,965 N245S probably damaging Het
Tlr6 T A 5: 64,954,985 H193L probably benign Het
Tomm20l T C 12: 71,117,578 V78A probably benign Het
Tsc2 G A 17: 24,621,166 probably benign Het
Usp2 A G 9: 44,075,657 D84G possibly damaging Het
V1ra8 A G 6: 90,203,484 N223S probably benign Het
Wnk2 C A 13: 49,070,977 R1122L probably damaging Het
Other mutations in Ptpa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02066:Ptpa APN 2 30443296 missense possibly damaging 0.83
IGL02073:Ptpa APN 2 30443350 missense probably damaging 1.00
IGL02201:Ptpa APN 2 30446377 missense possibly damaging 0.91
R1602:Ptpa UTSW 2 30437590 missense probably benign 0.22
R4080:Ptpa UTSW 2 30443305 missense probably damaging 1.00
R5186:Ptpa UTSW 2 30438355 critical splice donor site probably null
R6622:Ptpa UTSW 2 30437577 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTCAGAACTGGGAAGCAGG -3'
(R):5'- AGAGCCAGCAGTCACTATCC -3'

Sequencing Primer
(F):5'- ACCCCAGGCAGATGCTTC -3'
(R):5'- TGCTGAAACCCATACATTCCC -3'
Posted On2015-04-29