Incidental Mutation 'R3962:Actn4'
ID312126
Institutional Source Beutler Lab
Gene Symbol Actn4
Ensembl Gene ENSMUSG00000054808
Gene Nameactinin alpha 4
Synonyms
MMRRC Submission 040837-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.815) question?
Stock #R3962 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location28893248-28962340 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to A at 28898222 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000066880] [ENSMUST00000068045] [ENSMUST00000127210] [ENSMUST00000217157]
Predicted Effect probably benign
Transcript: ENSMUST00000066880
SMART Domains Protein: ENSMUSP00000069055
Gene: ENSMUSG00000054083

DomainStartEndE-ValueType
CysPc 27 349 7.8e-139 SMART
calpain_III 353 529 7.47e-72 SMART
SCOP:d1alva_ 552 720 3e-14 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000068045
AA Change: K575N

PolyPhen 2 Score 0.798 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000066068
Gene: ENSMUSG00000054808
AA Change: K575N

DomainStartEndE-ValueType
low complexity region 14 30 N/A INTRINSIC
CH 53 153 1.08e-24 SMART
CH 166 265 3.49e-24 SMART
SPEC 297 403 2.83e0 SMART
SPEC 417 518 3.78e-23 SMART
SPEC 532 639 8.64e-9 SMART
SPEC 653 752 3.56e0 SMART
EFh 770 798 1.92e-3 SMART
EFh 811 839 1.56e-3 SMART
efhand_Ca_insen 842 908 1.27e-36 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127210
SMART Domains Protein: ENSMUSP00000115436
Gene: ENSMUSG00000054808

DomainStartEndE-ValueType
low complexity region 14 30 N/A INTRINSIC
CH 53 153 1.08e-24 SMART
CH 166 265 1.03e-21 SMART
SPEC 297 403 2.83e0 SMART
SPEC 417 518 3.78e-23 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129338
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143584
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144909
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150493
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207765
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208299
Predicted Effect probably null
Transcript: ENSMUST00000216863
Predicted Effect probably damaging
Transcript: ENSMUST00000217157
AA Change: K575N

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
Meta Mutation Damage Score 0.216 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 93.9%
Validation Efficiency 96% (48/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Alpha actinins belong to the spectrin gene superfamily which represents a diverse group of cytoskeletal proteins, including the alpha and beta spectrins and dystrophins. Alpha actinin is an actin-binding protein with multiple roles in different cell types. In nonmuscle cells, the cytoskeletal isoform is found along microfilament bundles and adherens-type junctions, where it is involved in binding actin to the membrane. In contrast, skeletal, cardiac, and smooth muscle isoforms are localized to the Z-disc and analogous dense bodies, where they help anchor the myofibrillar actin filaments. This gene encodes a nonmuscle, alpha actinin isoform which is concentrated in the cytoplasm, and thought to be involved in metastatic processes. Mutations in this gene have been associated with focal and segmental glomerulosclerosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a disruption in this gene die either around birth or within a few months of birth. Those who do survive after birth show poor growth and kidney abnormalities including glomerulosclerosis. This is manifested functionally as proteinuria and abnormal blood urea nitrogen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019N19Rik A G 19: 58,789,109 Y82H probably damaging Het
9930111J21Rik1 T C 11: 48,947,976 T595A possibly damaging Het
Abca12 A T 1: 71,274,515 probably null Het
Ablim2 C T 5: 35,812,175 R211C probably damaging Het
AF529169 G A 9: 89,601,910 T478I probably damaging Het
B3gnt5 A G 16: 19,769,048 S6G probably benign Het
Bod1l T G 5: 41,808,721 E2667A probably benign Het
Ccdc13 G A 9: 121,798,939 probably benign Het
Ccdc15 G T 9: 37,320,486 R181S probably damaging Het
Ccnd1 G A 7: 144,934,050 T230M probably damaging Het
Cdcp1 T C 9: 123,182,381 T344A possibly damaging Het
Fam161a T C 11: 23,023,507 M275T possibly damaging Het
Fbxo15 A G 18: 84,959,247 T95A probably benign Het
Fndc5 T C 4: 129,139,895 V152A probably benign Het
Galk2 A T 2: 125,893,373 N107I probably benign Het
Glmn A T 5: 107,561,045 probably benign Het
Gm5082 T C 13: 41,656,418 noncoding transcript Het
Gm5828 C T 1: 16,768,644 noncoding transcript Het
Haus6 C T 4: 86,611,804 A4T possibly damaging Het
Hmgcs2 G A 3: 98,291,038 V86M possibly damaging Het
Hrg G A 16: 22,956,075 V152I possibly damaging Het
Itga2 A T 13: 114,839,518 V1106E probably damaging Het
Itga9 G A 9: 118,628,186 D122N possibly damaging Het
Kif21a T A 15: 90,985,409 E413V probably damaging Het
Klk1 A G 7: 44,229,549 T256A possibly damaging Het
L1td1 T C 4: 98,737,449 V627A probably benign Het
Larp4 C A 15: 100,012,145 Q652K probably damaging Het
Ltbp3 G A 19: 5,754,022 R854Q probably benign Het
Moxd2 T A 6: 40,885,397 M163L probably benign Het
Myo15 G A 11: 60,479,828 R1138H probably benign Het
Oasl2 A G 5: 114,897,747 D28G probably benign Het
Olfr777 A T 10: 129,268,666 I219N probably damaging Het
Platr26 A T 2: 71,719,505 noncoding transcript Het
Ptdss1 A G 13: 66,994,011 H411R probably benign Het
Ptpa A G 2: 30,435,660 T147A probably damaging Het
Rfx2 T C 17: 56,785,302 Y307C probably damaging Het
Rtn3 T C 19: 7,458,145 S142G probably damaging Het
Shisa6 A G 11: 66,217,476 V525A probably damaging Het
Slc4a3 A G 1: 75,556,754 S1007G probably damaging Het
Srsf3 C T 17: 29,036,456 probably benign Het
Taar8a A G 10: 24,077,156 I219M probably damaging Het
Tars2 A G 3: 95,754,756 probably null Het
Tfap2d A G 1: 19,118,965 N245S probably damaging Het
Tlr6 T A 5: 64,954,985 H193L probably benign Het
Tomm20l T C 12: 71,117,578 V78A probably benign Het
Tsc2 G A 17: 24,621,166 probably benign Het
Usp2 A G 9: 44,075,657 D84G possibly damaging Het
V1ra8 A G 6: 90,203,484 N223S probably benign Het
Wnk2 C A 13: 49,070,977 R1122L probably damaging Het
Other mutations in Actn4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01637:Actn4 APN 7 28904684 missense probably damaging 1.00
IGL02127:Actn4 APN 7 28897880 missense probably benign
IGL02192:Actn4 APN 7 28898400 missense possibly damaging 0.93
IGL02862:Actn4 APN 7 28912234 splice site probably benign
IGL03339:Actn4 APN 7 28901982 missense probably damaging 1.00
R0067:Actn4 UTSW 7 28911570 missense possibly damaging 0.67
R0067:Actn4 UTSW 7 28911570 missense possibly damaging 0.67
R0243:Actn4 UTSW 7 28905398 missense probably benign 0.29
R0689:Actn4 UTSW 7 28897049 missense probably damaging 1.00
R0845:Actn4 UTSW 7 28913430 missense probably damaging 1.00
R1469:Actn4 UTSW 7 28905328 missense probably benign 0.15
R1469:Actn4 UTSW 7 28898266 splice site probably benign
R1469:Actn4 UTSW 7 28905328 missense probably benign 0.15
R1581:Actn4 UTSW 7 28898646 missense probably benign 0.04
R1690:Actn4 UTSW 7 28911525 missense probably damaging 1.00
R1962:Actn4 UTSW 7 28894622 missense probably damaging 1.00
R2113:Actn4 UTSW 7 28898124 missense probably benign 0.42
R2215:Actn4 UTSW 7 28918753 missense possibly damaging 0.88
R2429:Actn4 UTSW 7 28898071 missense probably benign 0.00
R3945:Actn4 UTSW 7 28912236 splice site probably null
R3970:Actn4 UTSW 7 28962032 missense probably benign
R4909:Actn4 UTSW 7 28898657 missense probably damaging 1.00
R4985:Actn4 UTSW 7 28918986 missense probably damaging 1.00
R5155:Actn4 UTSW 7 28962017 critical splice donor site probably null
R5201:Actn4 UTSW 7 28916255 splice site probably null
R5668:Actn4 UTSW 7 28904550 missense probably damaging 1.00
R5818:Actn4 UTSW 7 28919019 missense probably damaging 1.00
R6046:Actn4 UTSW 7 28904619 missense probably benign 0.03
R6155:Actn4 UTSW 7 28896141 missense probably damaging 1.00
R6559:Actn4 UTSW 7 28907036 missense possibly damaging 0.87
R7224:Actn4 UTSW 7 28962084 missense probably benign 0.08
R7225:Actn4 UTSW 7 28898699 missense probably damaging 1.00
R7423:Actn4 UTSW 7 28894255 missense probably damaging 0.97
Z1088:Actn4 UTSW 7 28894578 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGCATGTCAGAGAGCCTGG -3'
(R):5'- GACCAGCTACATTTGGAGTATGC -3'

Sequencing Primer
(F):5'- AGAGCCTGGCCCACCTTC -3'
(R):5'- CCCTTCAACAACTGGATGGAGAG -3'
Posted On2015-04-29