Incidental Mutation 'R3962:Tsc2'
ID312150
Institutional Source Beutler Lab
Gene Symbol Tsc2
Ensembl Gene ENSMUSG00000002496
Gene Nametuberous sclerosis 2
Synonymstuberin, Nafld
MMRRC Submission 040837-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3962 (G1)
Quality Score219
Status Validated
Chromosome17
Chromosomal Location24595816-24632630 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to A at 24621166 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000154706 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097373] [ENSMUST00000226284] [ENSMUST00000226398] [ENSMUST00000227607] [ENSMUST00000227745] [ENSMUST00000228412]
Predicted Effect probably benign
Transcript: ENSMUST00000097373
SMART Domains Protein: ENSMUSP00000094986
Gene: ENSMUSG00000002496

DomainStartEndE-ValueType
Pfam:DUF3384 54 470 4e-103 PFAM
Pfam:Tuberin 555 903 5.9e-149 PFAM
low complexity region 1023 1054 N/A INTRINSIC
low complexity region 1271 1278 N/A INTRINSIC
low complexity region 1310 1328 N/A INTRINSIC
low complexity region 1330 1344 N/A INTRINSIC
low complexity region 1378 1398 N/A INTRINSIC
Pfam:Rap_GAP 1497 1685 1.3e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000226284
Predicted Effect probably benign
Transcript: ENSMUST00000226398
Predicted Effect probably benign
Transcript: ENSMUST00000227607
Predicted Effect probably benign
Transcript: ENSMUST00000227745
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227754
Predicted Effect probably benign
Transcript: ENSMUST00000228412
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 93.9%
Validation Efficiency 96% (48/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mutations in this gene lead to tuberous sclerosis complex. Its gene product is believed to be a tumor suppressor and is able to stimulate specific GTPases. The protein associates with hamartin in a cytosolic complex, possibly acting as a chaperone for hamartin. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants exhibit liver hypoplasia, open neural tube, thickened myocardium and die by embryonic day 9.5-12.5. Heterozygotes develop renal cystadenomas, liver hemangiomas (sometimes resulting in fatal bleeding) and lung adenomas. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019N19Rik A G 19: 58,789,109 Y82H probably damaging Het
9930111J21Rik1 T C 11: 48,947,976 T595A possibly damaging Het
Abca12 A T 1: 71,274,515 probably null Het
Ablim2 C T 5: 35,812,175 R211C probably damaging Het
Actn4 C A 7: 28,898,222 probably null Het
AF529169 G A 9: 89,601,910 T478I probably damaging Het
B3gnt5 A G 16: 19,769,048 S6G probably benign Het
Bod1l T G 5: 41,808,721 E2667A probably benign Het
Ccdc13 G A 9: 121,798,939 probably benign Het
Ccdc15 G T 9: 37,320,486 R181S probably damaging Het
Ccnd1 G A 7: 144,934,050 T230M probably damaging Het
Cdcp1 T C 9: 123,182,381 T344A possibly damaging Het
Fam161a T C 11: 23,023,507 M275T possibly damaging Het
Fbxo15 A G 18: 84,959,247 T95A probably benign Het
Fndc5 T C 4: 129,139,895 V152A probably benign Het
Galk2 A T 2: 125,893,373 N107I probably benign Het
Glmn A T 5: 107,561,045 probably benign Het
Gm5082 T C 13: 41,656,418 noncoding transcript Het
Gm5828 C T 1: 16,768,644 noncoding transcript Het
Haus6 C T 4: 86,611,804 A4T possibly damaging Het
Hmgcs2 G A 3: 98,291,038 V86M possibly damaging Het
Hrg G A 16: 22,956,075 V152I possibly damaging Het
Itga2 A T 13: 114,839,518 V1106E probably damaging Het
Itga9 G A 9: 118,628,186 D122N possibly damaging Het
Kif21a T A 15: 90,985,409 E413V probably damaging Het
Klk1 A G 7: 44,229,549 T256A possibly damaging Het
L1td1 T C 4: 98,737,449 V627A probably benign Het
Larp4 C A 15: 100,012,145 Q652K probably damaging Het
Ltbp3 G A 19: 5,754,022 R854Q probably benign Het
Moxd2 T A 6: 40,885,397 M163L probably benign Het
Myo15 G A 11: 60,479,828 R1138H probably benign Het
Oasl2 A G 5: 114,897,747 D28G probably benign Het
Olfr777 A T 10: 129,268,666 I219N probably damaging Het
Platr26 A T 2: 71,719,505 noncoding transcript Het
Ptdss1 A G 13: 66,994,011 H411R probably benign Het
Ptpa A G 2: 30,435,660 T147A probably damaging Het
Rfx2 T C 17: 56,785,302 Y307C probably damaging Het
Rtn3 T C 19: 7,458,145 S142G probably damaging Het
Shisa6 A G 11: 66,217,476 V525A probably damaging Het
Slc4a3 A G 1: 75,556,754 S1007G probably damaging Het
Srsf3 C T 17: 29,036,456 probably benign Het
Taar8a A G 10: 24,077,156 I219M probably damaging Het
Tars2 A G 3: 95,754,756 probably null Het
Tfap2d A G 1: 19,118,965 N245S probably damaging Het
Tlr6 T A 5: 64,954,985 H193L probably benign Het
Tomm20l T C 12: 71,117,578 V78A probably benign Het
Usp2 A G 9: 44,075,657 D84G possibly damaging Het
V1ra8 A G 6: 90,203,484 N223S probably benign Het
Wnk2 C A 13: 49,070,977 R1122L probably damaging Het
Other mutations in Tsc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Tsc2 APN 17 24608107 missense probably damaging 1.00
IGL00985:Tsc2 APN 17 24597131 missense probably damaging 1.00
IGL01386:Tsc2 APN 17 24613285 missense probably damaging 1.00
IGL01468:Tsc2 APN 17 24621097 missense possibly damaging 0.90
IGL01530:Tsc2 APN 17 24622662 missense possibly damaging 0.76
IGL02390:Tsc2 APN 17 24600453 missense probably damaging 1.00
IGL02398:Tsc2 APN 17 24621729 missense probably damaging 1.00
IGL02741:Tsc2 APN 17 24629969 missense probably damaging 1.00
IGL03191:Tsc2 APN 17 24628054 missense probably damaging 1.00
IGL03372:Tsc2 APN 17 24619470 missense probably damaging 1.00
IGL03412:Tsc2 APN 17 24597068 missense probably damaging 0.98
Twitch UTSW 17 24596742 unclassified probably null
PIT4515001:Tsc2 UTSW 17 24621147 missense probably benign 0.15
R0025:Tsc2 UTSW 17 24631004 splice site probably benign
R0025:Tsc2 UTSW 17 24631004 splice site probably benign
R0138:Tsc2 UTSW 17 24599626 missense possibly damaging 0.65
R0540:Tsc2 UTSW 17 24621712 missense probably damaging 1.00
R0570:Tsc2 UTSW 17 24626727 missense probably damaging 1.00
R0607:Tsc2 UTSW 17 24621712 missense probably damaging 1.00
R0826:Tsc2 UTSW 17 24596958 missense probably benign 0.04
R1430:Tsc2 UTSW 17 24599023 critical splice donor site probably null
R1440:Tsc2 UTSW 17 24614392 missense probably damaging 1.00
R1466:Tsc2 UTSW 17 24608973 missense probably damaging 1.00
R1466:Tsc2 UTSW 17 24608973 missense probably damaging 1.00
R1541:Tsc2 UTSW 17 24631976 missense probably damaging 1.00
R1717:Tsc2 UTSW 17 24597068 missense probably damaging 0.98
R1799:Tsc2 UTSW 17 24604408 missense probably benign
R2030:Tsc2 UTSW 17 24623470 splice site probably benign
R2147:Tsc2 UTSW 17 24621142 missense possibly damaging 0.62
R2888:Tsc2 UTSW 17 24631995 critical splice donor site probably null
R3609:Tsc2 UTSW 17 24622550 missense possibly damaging 0.74
R3610:Tsc2 UTSW 17 24622550 missense possibly damaging 0.74
R3811:Tsc2 UTSW 17 24629037 missense probably benign 0.09
R3895:Tsc2 UTSW 17 24599812 missense probably damaging 1.00
R3971:Tsc2 UTSW 17 24623588 missense probably damaging 1.00
R4018:Tsc2 UTSW 17 24625281 missense probably damaging 0.99
R4184:Tsc2 UTSW 17 24632016 missense probably benign 0.43
R4435:Tsc2 UTSW 17 24599713 missense probably benign 0.01
R4437:Tsc2 UTSW 17 24599713 missense probably benign 0.01
R4474:Tsc2 UTSW 17 24597264 missense probably damaging 0.98
R4703:Tsc2 UTSW 17 24604909 missense probably benign 0.13
R4731:Tsc2 UTSW 17 24603275 missense possibly damaging 0.72
R4732:Tsc2 UTSW 17 24603275 missense possibly damaging 0.72
R4733:Tsc2 UTSW 17 24603275 missense possibly damaging 0.72
R4817:Tsc2 UTSW 17 24596742 unclassified probably null
R4890:Tsc2 UTSW 17 24600035 missense probably damaging 1.00
R4922:Tsc2 UTSW 17 24600369 missense probably benign 0.22
R5119:Tsc2 UTSW 17 24603280 missense probably benign 0.00
R5393:Tsc2 UTSW 17 24600396 missense possibly damaging 0.89
R5785:Tsc2 UTSW 17 24599887 unclassified probably null
R5838:Tsc2 UTSW 17 24613216 missense probably benign 0.01
R5857:Tsc2 UTSW 17 24600007 missense probably damaging 0.99
R5911:Tsc2 UTSW 17 24600387 missense possibly damaging 0.63
R5988:Tsc2 UTSW 17 24620766 missense probably damaging 1.00
R6275:Tsc2 UTSW 17 24600420 missense probably benign 0.00
R6290:Tsc2 UTSW 17 24596910 missense probably benign 0.04
R6371:Tsc2 UTSW 17 24626714 missense probably benign 0.00
R6467:Tsc2 UTSW 17 24609127 missense probably benign 0.04
R6577:Tsc2 UTSW 17 24610499 missense probably damaging 1.00
R6728:Tsc2 UTSW 17 24621124 missense probably damaging 1.00
R6918:Tsc2 UTSW 17 24613229 missense probably damaging 1.00
R6995:Tsc2 UTSW 17 24628054 missense probably damaging 1.00
R7026:Tsc2 UTSW 17 24626739 missense probably damaging 0.99
R7136:Tsc2 UTSW 17 24613280 missense probably benign 0.00
R7236:Tsc2 UTSW 17 24623594 missense possibly damaging 0.82
R7243:Tsc2 UTSW 17 24599630 missense probably benign 0.02
R7249:Tsc2 UTSW 17 24607755 missense probably damaging 1.00
R7450:Tsc2 UTSW 17 24600031 missense probably damaging 1.00
R7522:Tsc2 UTSW 17 24630965 missense not run
R7529:Tsc2 UTSW 17 24597948 missense not run
Predicted Primers PCR Primer
(F):5'- CTCCGTGATTTTGGAGGCTC -3'
(R):5'- AGTCATTTTGCCAGGGTTACTCTG -3'

Sequencing Primer
(F):5'- GCTCAGAAAGGAAAGCCTGATCTTAC -3'
(R):5'- GCCAGGGTTACTCTGTCCACTG -3'
Posted On2015-04-29