Incidental Mutation 'R3965:5330417C22Rik'
ID312293
Institutional Source Beutler Lab
Gene Symbol 5330417C22Rik
Ensembl Gene ENSMUSG00000040412
Gene NameRIKEN cDNA 5330417C22 gene
Synonyms
MMRRC Submission 040934-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.151) question?
Stock #R3965 (G1)
Quality Score220
Status Validated
Chromosome3
Chromosomal Location108455694-108536536 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 108458449 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 998 (D998G)
Ref Sequence ENSEMBL: ENSMUSP00000102236 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048012] [ENSMUST00000106625] [ENSMUST00000106626] [ENSMUST00000185128]
Predicted Effect probably damaging
Transcript: ENSMUST00000048012
AA Change: D896G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000040128
Gene: ENSMUSG00000040412
AA Change: D896G

DomainStartEndE-ValueType
internal_repeat_1 3 212 1.11e-6 PROSPERO
internal_repeat_1 289 522 1.11e-6 PROSPERO
transmembrane domain 806 828 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106625
AA Change: D998G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102236
Gene: ENSMUSG00000040412
AA Change: D998G

DomainStartEndE-ValueType
signal peptide 1 41 N/A INTRINSIC
internal_repeat_1 48 310 8.31e-11 PROSPERO
internal_repeat_1 325 620 8.31e-11 PROSPERO
transmembrane domain 904 926 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106626
SMART Domains Protein: ENSMUSP00000102237
Gene: ENSMUSG00000040412

DomainStartEndE-ValueType
signal peptide 1 41 N/A INTRINSIC
internal_repeat_1 48 178 2.5e-7 PROSPERO
internal_repeat_1 275 421 2.5e-7 PROSPERO
transmembrane domain 854 876 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000185128
SMART Domains Protein: ENSMUSP00000138870
Gene: ENSMUSG00000040412

DomainStartEndE-ValueType
low complexity region 25 31 N/A INTRINSIC
Meta Mutation Damage Score 0.374 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Expression of this gene is induced by estrogen and the encoded protein has been characterized as a transmembrane protein. The encoded protein has been found in to correlate with survival in certain carcinomas (PMID: 21102415) and may be important for cellular response to stress (PMID: 21072319). Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2012]
PHENOTYPE: Male homozygous mice are infertile. Microscopic analysis revealed defective spermatogenesis in the testis, and hypospermia and defective spermatozoa in the epididymides. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930548H24Rik T A 5: 31,487,991 C363S probably benign Het
C1galt1c1 A T X: 38,631,576 V181E probably benign Het
Cep70 T A 9: 99,298,534 F581I probably damaging Het
Cfap74 T A 4: 155,446,717 M809K probably damaging Het
Clic6 T C 16: 92,498,844 S131P probably benign Het
Ctc1 T A 11: 69,031,128 V800D probably damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dlec1 A G 9: 119,128,581 I878V probably benign Het
Esyt3 T A 9: 99,320,322 D512V probably damaging Het
Ewsr1 T C 11: 5,083,476 Y232C unknown Het
Exoc2 G A 13: 30,877,582 S492L probably benign Het
Gm12169 T A 11: 46,535,513 V149D possibly damaging Het
Gprc6a CAAA CA 10: 51,615,680 probably null Het
Grin2c G A 11: 115,260,994 R47W probably damaging Het
Igfn1 T C 1: 135,967,819 T1670A probably benign Het
Med31 C T 11: 72,211,929 A118T probably benign Het
Mia2 T A 12: 59,176,372 S489T probably damaging Het
Mov10l1 A G 15: 89,012,163 I737V probably benign Het
Muc2 G A 7: 141,699,664 R120H probably benign Het
Nckap1l T A 15: 103,464,589 C276* probably null Het
Nrap T C 19: 56,342,144 S1126G probably damaging Het
Oas1c A G 5: 120,808,718 F16L probably damaging Het
Olfr1487 T C 19: 13,619,201 L13P probably damaging Het
Olfr374 G A 8: 72,110,264 G233R probably damaging Het
Olfr916 G A 9: 38,657,727 L222F probably benign Het
Olfr979 A T 9: 40,000,471 V252E possibly damaging Het
Pik3c2g A G 6: 139,855,292 M388V possibly damaging Het
Pls1 T C 9: 95,785,612 Q81R probably benign Het
Pole A G 5: 110,312,782 K1143E probably damaging Het
Ppp6r2 A G 15: 89,259,114 K155E probably benign Het
Rxra T A 2: 27,752,306 probably benign Het
Susd5 A G 9: 114,096,192 E381G possibly damaging Het
Svs2 T C 2: 164,237,742 T82A possibly damaging Het
Syt14 A T 1: 192,901,867 H413Q probably benign Het
Tg T A 15: 66,684,190 D910E probably benign Het
Tpcn1 G T 5: 120,556,575 T143K probably damaging Het
Trbv5 G T 6: 41,062,408 probably benign Het
Trhr T A 15: 44,197,699 I205N possibly damaging Het
Trp73 A G 4: 154,062,036 V422A probably benign Het
Trpc6 G A 9: 8,626,621 C324Y probably damaging Het
Upf1 C T 8: 70,338,460 R544H probably damaging Het
Zfhx4 G T 3: 5,403,847 V3022F probably damaging Het
Zswim8 G A 14: 20,713,073 V347I probably benign Het
Other mutations in 5330417C22Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01552:5330417C22Rik APN 3 108481312 missense possibly damaging 0.48
IGL02079:5330417C22Rik APN 3 108481359 missense possibly damaging 0.91
IGL02268:5330417C22Rik APN 3 108467797 missense probably benign 0.00
IGL02869:5330417C22Rik APN 3 108472866 missense probably benign 0.34
IGL02891:5330417C22Rik APN 3 108464392 missense probably benign 0.03
IGL03088:5330417C22Rik APN 3 108536358 missense probably damaging 1.00
IGL03345:5330417C22Rik APN 3 108492016 missense possibly damaging 0.68
IGL03398:5330417C22Rik APN 3 108461221 missense possibly damaging 0.94
IGL03138:5330417C22Rik UTSW 3 108471993 missense probably benign 0.08
R0325:5330417C22Rik UTSW 3 108461251 missense probably damaging 1.00
R0730:5330417C22Rik UTSW 3 108469535 missense probably benign 0.00
R0844:5330417C22Rik UTSW 3 108480963 splice site probably benign
R1646:5330417C22Rik UTSW 3 108462990 missense probably damaging 1.00
R1666:5330417C22Rik UTSW 3 108469997 missense probably benign 0.01
R1726:5330417C22Rik UTSW 3 108467868 missense possibly damaging 0.67
R2202:5330417C22Rik UTSW 3 108475043 missense probably damaging 1.00
R2203:5330417C22Rik UTSW 3 108475043 missense probably damaging 1.00
R2204:5330417C22Rik UTSW 3 108475043 missense probably damaging 1.00
R2205:5330417C22Rik UTSW 3 108475043 missense probably damaging 1.00
R2249:5330417C22Rik UTSW 3 108471410 nonsense probably null
R2443:5330417C22Rik UTSW 3 108481349 missense probably damaging 1.00
R4171:5330417C22Rik UTSW 3 108460943 missense probably benign 0.30
R4785:5330417C22Rik UTSW 3 108458227 utr 3 prime probably benign
R4810:5330417C22Rik UTSW 3 108470011 splice site probably benign
R4862:5330417C22Rik UTSW 3 108467833 missense probably benign
R4923:5330417C22Rik UTSW 3 108471968 critical splice donor site probably null
R5040:5330417C22Rik UTSW 3 108475001 missense probably damaging 1.00
R5153:5330417C22Rik UTSW 3 108472747 missense possibly damaging 0.75
R5405:5330417C22Rik UTSW 3 108467786 nonsense probably null
R5609:5330417C22Rik UTSW 3 108471415 missense probably damaging 0.96
R5663:5330417C22Rik UTSW 3 108492083 missense probably benign 0.00
R6194:5330417C22Rik UTSW 3 108465779 missense probably benign 0.05
R6303:5330417C22Rik UTSW 3 108461256 missense probably damaging 1.00
R6304:5330417C22Rik UTSW 3 108461256 missense probably damaging 1.00
R6381:5330417C22Rik UTSW 3 108481814 missense possibly damaging 0.52
R6676:5330417C22Rik UTSW 3 108469915 missense probably damaging 1.00
R6852:5330417C22Rik UTSW 3 108482338 missense probably damaging 1.00
X0022:5330417C22Rik UTSW 3 108459746 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATAAGGCCACAATGAAGAGATTCC -3'
(R):5'- TCACGCTCTGACTGAGTCTG -3'

Sequencing Primer
(F):5'- TGAAGAGATTCCCAGCAGC -3'
(R):5'- CTCTGACTGAGTCTGCGGAGAG -3'
Posted On2015-04-29