Incidental Mutation 'R3967:Rb1cc1'
ID312381
Institutional Source Beutler Lab
Gene Symbol Rb1cc1
Ensembl Gene ENSMUSG00000025907
Gene NameRB1-inducible coiled-coil 1
SynonymsCc1, 2900055E04Rik, LaXp180, 5930404L04Rik, Fip200
MMRRC Submission 040838-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3967 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location6206197-6276648 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 6248270 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000124676 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027040] [ENSMUST00000162795]
Predicted Effect probably benign
Transcript: ENSMUST00000027040
SMART Domains Protein: ENSMUSP00000027040
Gene: ENSMUSG00000025907

DomainStartEndE-ValueType
SCOP:d1euvb_ 1 51 7e-4 SMART
Blast:UBQ 3 76 8e-12 BLAST
low complexity region 471 486 N/A INTRINSIC
low complexity region 643 653 N/A INTRINSIC
low complexity region 658 674 N/A INTRINSIC
coiled coil region 859 921 N/A INTRINSIC
low complexity region 1033 1045 N/A INTRINSIC
low complexity region 1055 1066 N/A INTRINSIC
SCOP:d1eq1a_ 1159 1305 1e-3 SMART
low complexity region 1374 1388 N/A INTRINSIC
Pfam:ATG11 1447 1583 5.6e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159206
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159661
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159802
Predicted Effect probably benign
Transcript: ENSMUST00000161327
SMART Domains Protein: ENSMUSP00000125348
Gene: ENSMUSG00000025907

DomainStartEndE-ValueType
low complexity region 351 366 N/A INTRINSIC
low complexity region 523 533 N/A INTRINSIC
low complexity region 538 554 N/A INTRINSIC
coiled coil region 738 800 N/A INTRINSIC
low complexity region 913 925 N/A INTRINSIC
low complexity region 935 946 N/A INTRINSIC
SCOP:d1eq1a_ 1039 1174 3e-3 SMART
low complexity region 1254 1268 N/A INTRINSIC
Pfam:ATG11 1327 1463 6.7e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162257
SMART Domains Protein: ENSMUSP00000125334
Gene: ENSMUSG00000025907

DomainStartEndE-ValueType
coiled coil region 33 331 N/A INTRINSIC
low complexity region 335 355 N/A INTRINSIC
coiled coil region 363 483 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162795
SMART Domains Protein: ENSMUSP00000124676
Gene: ENSMUSG00000025907

DomainStartEndE-ValueType
SCOP:d1euvb_ 1 51 2e-4 SMART
Blast:UBQ 3 76 4e-12 BLAST
low complexity region 454 469 N/A INTRINSIC
low complexity region 626 636 N/A INTRINSIC
low complexity region 641 657 N/A INTRINSIC
coiled coil region 842 865 N/A INTRINSIC
Meta Mutation Damage Score 0.0556 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.2%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene interacts with signaling pathways to coordinately regulate cell growth, cell proliferation, apoptosis, autophagy, and cell migration. This tumor suppressor also enhances retinoblastoma 1 gene expression in cancer cells. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality at mid/late gestation associated with heart failure and liver degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018B08Rik G T 8: 121,539,980 Q56K possibly damaging Het
Adam18 C A 8: 24,629,710 V518L probably benign Het
Akap6 A T 12: 53,141,453 K1883N probably damaging Het
Arhgef12 C A 9: 43,005,551 R432L probably damaging Het
Armcx6 G T X: 134,749,756 H109N possibly damaging Het
Ctnnd2 C A 15: 30,646,929 A257E possibly damaging Het
Depdc5 T A 5: 32,944,115 C322* probably null Het
Enpp7 T C 11: 118,991,001 I324T probably damaging Het
Gm14401 T C 2: 177,086,996 Y292H possibly damaging Het
Gm6871 A T 7: 41,546,724 H196Q probably damaging Het
Gm9964 T C 11: 79,296,376 T82A unknown Het
Gria2 T A 3: 80,710,777 Q317L possibly damaging Het
Grtp1 G A 8: 13,189,705 T134I probably benign Het
Itpkb A T 1: 180,327,798 probably benign Het
Kbtbd12 A G 6: 88,618,506 V114A probably benign Het
Lama3 A T 18: 12,580,341 K3230M probably damaging Het
Ly75 T C 2: 60,327,873 I1023V possibly damaging Het
Myof C T 19: 37,901,263 V1287M probably damaging Het
Myof T G 19: 38,022,610 D60A possibly damaging Het
Narf A T 11: 121,238,421 E10D possibly damaging Het
Nlrx1 A T 9: 44,255,425 probably benign Het
Olfr512 A G 7: 108,713,853 M155V probably benign Het
Olfr921 A G 9: 38,775,368 T38A probably benign Het
Pabpc5 A G X: 119,928,624 E212G probably benign Het
Pidd1 A G 7: 141,439,082 F829L possibly damaging Het
Pik3r2 G A 8: 70,770,421 R452C probably benign Het
Pkn2 A G 3: 142,809,677 C658R probably damaging Het
Psd C T 19: 46,324,406 R175H probably benign Het
Rab39 G A 9: 53,686,632 A111V possibly damaging Het
Rnf39 C A 17: 36,943,143 T19K probably damaging Het
Slc16a3 C T 11: 120,955,425 T60M possibly damaging Het
Slc26a4 G T 12: 31,528,687 H656N probably damaging Het
Slc27a1 A G 8: 71,579,787 E184G probably damaging Het
Smc6 T C 12: 11,298,326 V742A probably benign Het
Thoc1 T A 18: 9,968,787 V186D probably damaging Het
Uhrf2 T C 19: 30,079,915 V491A probably damaging Het
Uri1 A G 7: 37,965,502 V253A possibly damaging Het
Vmn2r83 T A 10: 79,491,320 N587K probably benign Het
Vmn2r88 A T 14: 51,413,190 Y120F probably benign Het
Wwox G A 8: 114,488,933 A149T probably damaging Het
Zfp536 T C 7: 37,473,830 *282W probably null Het
Other mutations in Rb1cc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Rb1cc1 APN 1 6249506 missense probably damaging 0.97
IGL00590:Rb1cc1 APN 1 6238296 missense probably damaging 1.00
IGL00678:Rb1cc1 APN 1 6234085 missense probably damaging 1.00
IGL00705:Rb1cc1 APN 1 6244133 missense probably benign 0.00
IGL00957:Rb1cc1 APN 1 6249539 missense probably damaging 1.00
IGL01363:Rb1cc1 APN 1 6250109 missense probably benign 0.06
IGL01599:Rb1cc1 APN 1 6248771 nonsense probably null
IGL01610:Rb1cc1 APN 1 6248481 missense probably benign 0.03
IGL01929:Rb1cc1 APN 1 6240159 missense possibly damaging 0.82
IGL01978:Rb1cc1 APN 1 6238368 missense probably damaging 1.00
IGL02312:Rb1cc1 APN 1 6265623 critical splice donor site probably null
IGL02471:Rb1cc1 APN 1 6240051 missense probably benign 0.01
IGL02677:Rb1cc1 APN 1 6249419 missense probably benign
IGL02702:Rb1cc1 APN 1 6240023 missense probably damaging 0.99
IGL02816:Rb1cc1 APN 1 6262828 splice site probably benign
IGL02899:Rb1cc1 APN 1 6264583 missense probably damaging 1.00
IGL02988:Rb1cc1 UTSW 1 6247811 critical splice donor site probably null
R0020:Rb1cc1 UTSW 1 6264548 missense possibly damaging 0.86
R0254:Rb1cc1 UTSW 1 6262847 missense probably damaging 1.00
R0390:Rb1cc1 UTSW 1 6248634 missense probably damaging 1.00
R0466:Rb1cc1 UTSW 1 6263267 splice site probably null
R0482:Rb1cc1 UTSW 1 6240323 missense probably damaging 1.00
R0510:Rb1cc1 UTSW 1 6249171 missense probably benign 0.00
R0512:Rb1cc1 UTSW 1 6248543 missense probably damaging 1.00
R0616:Rb1cc1 UTSW 1 6244262 missense possibly damaging 0.80
R0617:Rb1cc1 UTSW 1 6248790 missense possibly damaging 0.83
R0837:Rb1cc1 UTSW 1 6234271 unclassified probably null
R1399:Rb1cc1 UTSW 1 6249818 missense probably benign 0.00
R1532:Rb1cc1 UTSW 1 6249734 missense probably benign 0.00
R1542:Rb1cc1 UTSW 1 6244249 missense possibly damaging 0.82
R1746:Rb1cc1 UTSW 1 6263013 splice site probably null
R1764:Rb1cc1 UTSW 1 6214680 intron probably benign
R1968:Rb1cc1 UTSW 1 6248195 splice site probably null
R2025:Rb1cc1 UTSW 1 6245309 missense probably damaging 1.00
R2076:Rb1cc1 UTSW 1 6250038 missense possibly damaging 0.82
R2101:Rb1cc1 UTSW 1 6249335 missense probably benign
R2249:Rb1cc1 UTSW 1 6272724 missense probably damaging 1.00
R3176:Rb1cc1 UTSW 1 6249366 missense probably benign
R3276:Rb1cc1 UTSW 1 6249366 missense probably benign
R3716:Rb1cc1 UTSW 1 6270690 critical splice acceptor site probably null
R3747:Rb1cc1 UTSW 1 6248742 missense possibly damaging 0.92
R3850:Rb1cc1 UTSW 1 6250113 missense probably benign 0.22
R3969:Rb1cc1 UTSW 1 6248270 splice site probably benign
R3972:Rb1cc1 UTSW 1 6249000 missense probably benign 0.00
R4166:Rb1cc1 UTSW 1 6265663 intron probably benign
R4168:Rb1cc1 UTSW 1 6230024 missense probably damaging 1.00
R4358:Rb1cc1 UTSW 1 6245637 missense probably damaging 0.99
R4370:Rb1cc1 UTSW 1 6248547 missense probably damaging 1.00
R4869:Rb1cc1 UTSW 1 6215021 intron probably benign
R4945:Rb1cc1 UTSW 1 6249627 missense probably benign 0.24
R5111:Rb1cc1 UTSW 1 6214634 intron probably benign
R5175:Rb1cc1 UTSW 1 6248321 missense probably benign
R5196:Rb1cc1 UTSW 1 6234230 missense probably damaging 0.99
R5271:Rb1cc1 UTSW 1 6249193 nonsense probably null
R5341:Rb1cc1 UTSW 1 6215042 intron probably benign
R5952:Rb1cc1 UTSW 1 6248182 missense probably benign
R5992:Rb1cc1 UTSW 1 6233996 missense probably damaging 1.00
R6054:Rb1cc1 UTSW 1 6249834 missense probably benign 0.01
R6064:Rb1cc1 UTSW 1 6249734 missense probably benign 0.00
R6313:Rb1cc1 UTSW 1 6244133 missense probably benign 0.00
R6345:Rb1cc1 UTSW 1 6263257 missense probably benign 0.00
R6488:Rb1cc1 UTSW 1 6270727 missense probably damaging 0.97
R6566:Rb1cc1 UTSW 1 6249092 missense probably benign 0.15
R6739:Rb1cc1 UTSW 1 6234230 missense probably damaging 0.99
R6829:Rb1cc1 UTSW 1 6249264 missense probably benign 0.04
R6945:Rb1cc1 UTSW 1 6261032 missense probably damaging 1.00
R6976:Rb1cc1 UTSW 1 6262902 missense probably benign 0.01
Z1088:Rb1cc1 UTSW 1 6249018 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TCTACACCAGCATGTACTTGCC -3'
(R):5'- GAAGCTTGGTGAACAGGTTG -3'

Sequencing Primer
(F):5'- GCATGTACTTGCCCTACATAATTTGG -3'
(R):5'- GTATGAGCATCGATACTATCTGGAG -3'
Posted On2015-04-29