Incidental Mutation 'R3967:Kbtbd12'
ID312389
Institutional Source Beutler Lab
Gene Symbol Kbtbd12
Ensembl Gene ENSMUSG00000033182
Gene Namekelch repeat and BTB (POZ) domain containing 12
SynonymsKlhdc6, 4933428M03Rik, 4833415F11Rik
MMRRC Submission 040838-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.379) question?
Stock #R3967 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location88545114-88637950 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 88618506 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 114 (V114A)
Ref Sequence ENSEMBL: ENSMUSP00000112581 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120933] [ENSMUST00000184664] [ENSMUST00000184878]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000038804
SMART Domains Protein: ENSMUSP00000047155
Gene: ENSMUSG00000033182

DomainStartEndE-ValueType
BTB 29 126 1.39e-23 SMART
BACK 131 233 6.69e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120933
AA Change: V114A

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000112581
Gene: ENSMUSG00000033182
AA Change: V114A

DomainStartEndE-ValueType
BTB 29 126 1.39e-23 SMART
BACK 131 233 6.69e-30 SMART
Kelch 384 434 9.15e-3 SMART
Kelch 435 490 4.3e-8 SMART
Kelch 491 550 1.01e-1 SMART
Kelch 551 601 1.92e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184591
Predicted Effect probably benign
Transcript: ENSMUST00000184664
SMART Domains Protein: ENSMUSP00000139069
Gene: ENSMUSG00000033182

DomainStartEndE-ValueType
Pfam:BTB 19 77 6.2e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000184878
SMART Domains Protein: ENSMUSP00000139333
Gene: ENSMUSG00000033182

DomainStartEndE-ValueType
Kelch 30 67 9.94e-1 SMART
Kelch 68 127 1.01e-1 SMART
Kelch 128 178 1.92e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203223
Meta Mutation Damage Score 0.128 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.2%
Validation Efficiency 100% (44/44)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018B08Rik G T 8: 121,539,980 Q56K possibly damaging Het
Adam18 C A 8: 24,629,710 V518L probably benign Het
Akap6 A T 12: 53,141,453 K1883N probably damaging Het
Arhgef12 C A 9: 43,005,551 R432L probably damaging Het
Armcx6 G T X: 134,749,756 H109N possibly damaging Het
Ctnnd2 C A 15: 30,646,929 A257E possibly damaging Het
Depdc5 T A 5: 32,944,115 C322* probably null Het
Enpp7 T C 11: 118,991,001 I324T probably damaging Het
Gm14401 T C 2: 177,086,996 Y292H possibly damaging Het
Gm6871 A T 7: 41,546,724 H196Q probably damaging Het
Gm9964 T C 11: 79,296,376 T82A unknown Het
Gria2 T A 3: 80,710,777 Q317L possibly damaging Het
Grtp1 G A 8: 13,189,705 T134I probably benign Het
Itpkb A T 1: 180,327,798 probably benign Het
Lama3 A T 18: 12,580,341 K3230M probably damaging Het
Ly75 T C 2: 60,327,873 I1023V possibly damaging Het
Myof C T 19: 37,901,263 V1287M probably damaging Het
Myof T G 19: 38,022,610 D60A possibly damaging Het
Narf A T 11: 121,238,421 E10D possibly damaging Het
Nlrx1 A T 9: 44,255,425 probably benign Het
Olfr512 A G 7: 108,713,853 M155V probably benign Het
Olfr921 A G 9: 38,775,368 T38A probably benign Het
Pabpc5 A G X: 119,928,624 E212G probably benign Het
Pidd1 A G 7: 141,439,082 F829L possibly damaging Het
Pik3r2 G A 8: 70,770,421 R452C probably benign Het
Pkn2 A G 3: 142,809,677 C658R probably damaging Het
Psd C T 19: 46,324,406 R175H probably benign Het
Rab39 G A 9: 53,686,632 A111V possibly damaging Het
Rb1cc1 T A 1: 6,248,270 probably benign Het
Rnf39 C A 17: 36,943,143 T19K probably damaging Het
Slc16a3 C T 11: 120,955,425 T60M possibly damaging Het
Slc26a4 G T 12: 31,528,687 H656N probably damaging Het
Slc27a1 A G 8: 71,579,787 E184G probably damaging Het
Smc6 T C 12: 11,298,326 V742A probably benign Het
Thoc1 T A 18: 9,968,787 V186D probably damaging Het
Uhrf2 T C 19: 30,079,915 V491A probably damaging Het
Uri1 A G 7: 37,965,502 V253A possibly damaging Het
Vmn2r83 T A 10: 79,491,320 N587K probably benign Het
Vmn2r88 A T 14: 51,413,190 Y120F probably benign Het
Wwox G A 8: 114,488,933 A149T probably damaging Het
Zfp536 T C 7: 37,473,830 *282W probably null Het
Other mutations in Kbtbd12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01600:Kbtbd12 APN 6 88618558 missense probably benign 0.08
IGL01845:Kbtbd12 APN 6 88613940 missense probably benign 0.16
IGL02447:Kbtbd12 APN 6 88618694 missense probably damaging 1.00
IGL02623:Kbtbd12 APN 6 88618389 missense probably damaging 1.00
IGL02851:Kbtbd12 APN 6 88618329 missense probably benign 0.18
R0334:Kbtbd12 UTSW 6 88617906 missense probably damaging 0.99
R1689:Kbtbd12 UTSW 6 88618585 missense probably damaging 1.00
R1712:Kbtbd12 UTSW 6 88618694 missense probably damaging 1.00
R1777:Kbtbd12 UTSW 6 88618060 missense probably benign 0.00
R2037:Kbtbd12 UTSW 6 88617797 missense probably benign 0.00
R4660:Kbtbd12 UTSW 6 88617790 missense probably benign 0.44
R4785:Kbtbd12 UTSW 6 88618021 missense probably damaging 1.00
R5224:Kbtbd12 UTSW 6 88617699 intron probably benign
R5568:Kbtbd12 UTSW 6 88618627 missense probably damaging 1.00
R6051:Kbtbd12 UTSW 6 88617948 missense possibly damaging 0.69
R6412:Kbtbd12 UTSW 6 88618656 missense probably damaging 1.00
R6525:Kbtbd12 UTSW 6 88614080 missense probably benign 0.29
R6776:Kbtbd12 UTSW 6 88618266 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AGCTTCGATGTCAAGTATTTCTCC -3'
(R):5'- GAAATTCCCTTGCCACAGACTG -3'

Sequencing Primer
(F):5'- GTCAAGTATTTCTCCATGAAGGC -3'
(R):5'- TTCAAGGCTATGTTCACCTGTGGAC -3'
Posted On2015-04-29