Incidental Mutation 'R3967:Gm6871'
ID312391
Institutional Source Beutler Lab
Gene Symbol Gm6871
Ensembl Gene ENSMUSG00000090744
Gene Namepredicted gene 6871
Synonyms
MMRRC Submission 040838-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.253) question?
Stock #R3967 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location41545674-41573662 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 41546724 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 196 (H196Q)
Ref Sequence ENSEMBL: ENSMUSP00000105843 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073410] [ENSMUST00000110214] [ENSMUST00000164677]
Predicted Effect probably benign
Transcript: ENSMUST00000073410
AA Change: H89Q

PolyPhen 2 Score 0.056 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000073117
Gene: ENSMUSG00000090744
AA Change: H89Q

DomainStartEndE-ValueType
KRAB 4 64 1.19e-16 SMART
ZnF_C2H2 131 153 3.44e-4 SMART
ZnF_C2H2 159 181 5.99e-4 SMART
ZnF_C2H2 187 209 3.34e-2 SMART
ZnF_C2H2 215 237 5.99e-4 SMART
ZnF_C2H2 243 265 1.28e-3 SMART
ZnF_C2H2 271 293 3.69e-4 SMART
ZnF_C2H2 299 321 1.36e-2 SMART
ZnF_C2H2 327 349 3.21e-4 SMART
ZnF_C2H2 355 377 2.61e-4 SMART
ZnF_C2H2 383 405 3.16e-3 SMART
ZnF_C2H2 411 433 5.14e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110214
AA Change: H196Q

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000105843
Gene: ENSMUSG00000090744
AA Change: H196Q

DomainStartEndE-ValueType
KRAB 111 171 1.19e-16 SMART
ZnF_C2H2 238 260 3.44e-4 SMART
ZnF_C2H2 266 288 5.99e-4 SMART
ZnF_C2H2 294 316 3.34e-2 SMART
ZnF_C2H2 322 344 5.99e-4 SMART
ZnF_C2H2 350 372 1.28e-3 SMART
ZnF_C2H2 378 400 3.69e-4 SMART
ZnF_C2H2 406 428 1.36e-2 SMART
ZnF_C2H2 434 456 3.21e-4 SMART
ZnF_C2H2 462 484 2.61e-4 SMART
ZnF_C2H2 490 512 3.16e-3 SMART
ZnF_C2H2 518 540 5.14e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000164677
AA Change: I47N

PolyPhen 2 Score 0.796 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000131240
Gene: ENSMUSG00000090744
AA Change: I47N

DomainStartEndE-ValueType
internal_repeat_1 21 67 6.62e-7 PROSPERO
internal_repeat_1 105 151 6.62e-7 PROSPERO
Meta Mutation Damage Score 0.0228 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.2%
Validation Efficiency 100% (44/44)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018B08Rik G T 8: 121,539,980 Q56K possibly damaging Het
Adam18 C A 8: 24,629,710 V518L probably benign Het
Akap6 A T 12: 53,141,453 K1883N probably damaging Het
Arhgef12 C A 9: 43,005,551 R432L probably damaging Het
Armcx6 G T X: 134,749,756 H109N possibly damaging Het
Ctnnd2 C A 15: 30,646,929 A257E possibly damaging Het
Depdc5 T A 5: 32,944,115 C322* probably null Het
Enpp7 T C 11: 118,991,001 I324T probably damaging Het
Gm14401 T C 2: 177,086,996 Y292H possibly damaging Het
Gm9964 T C 11: 79,296,376 T82A unknown Het
Gria2 T A 3: 80,710,777 Q317L possibly damaging Het
Grtp1 G A 8: 13,189,705 T134I probably benign Het
Itpkb A T 1: 180,327,798 probably benign Het
Kbtbd12 A G 6: 88,618,506 V114A probably benign Het
Lama3 A T 18: 12,580,341 K3230M probably damaging Het
Ly75 T C 2: 60,327,873 I1023V possibly damaging Het
Myof C T 19: 37,901,263 V1287M probably damaging Het
Myof T G 19: 38,022,610 D60A possibly damaging Het
Narf A T 11: 121,238,421 E10D possibly damaging Het
Nlrx1 A T 9: 44,255,425 probably benign Het
Olfr512 A G 7: 108,713,853 M155V probably benign Het
Olfr921 A G 9: 38,775,368 T38A probably benign Het
Pabpc5 A G X: 119,928,624 E212G probably benign Het
Pidd1 A G 7: 141,439,082 F829L possibly damaging Het
Pik3r2 G A 8: 70,770,421 R452C probably benign Het
Pkn2 A G 3: 142,809,677 C658R probably damaging Het
Psd C T 19: 46,324,406 R175H probably benign Het
Rab39 G A 9: 53,686,632 A111V possibly damaging Het
Rb1cc1 T A 1: 6,248,270 probably benign Het
Rnf39 C A 17: 36,943,143 T19K probably damaging Het
Slc16a3 C T 11: 120,955,425 T60M possibly damaging Het
Slc26a4 G T 12: 31,528,687 H656N probably damaging Het
Slc27a1 A G 8: 71,579,787 E184G probably damaging Het
Smc6 T C 12: 11,298,326 V742A probably benign Het
Thoc1 T A 18: 9,968,787 V186D probably damaging Het
Uhrf2 T C 19: 30,079,915 V491A probably damaging Het
Uri1 A G 7: 37,965,502 V253A possibly damaging Het
Vmn2r83 T A 10: 79,491,320 N587K probably benign Het
Vmn2r88 A T 14: 51,413,190 Y120F probably benign Het
Wwox G A 8: 114,488,933 A149T probably damaging Het
Zfp536 T C 7: 37,473,830 *282W probably null Het
Other mutations in Gm6871
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00586:Gm6871 APN 7 41546421 missense possibly damaging 0.67
R0419:Gm6871 UTSW 7 41573445 missense probably benign 0.00
R1005:Gm6871 UTSW 7 41546258 missense probably damaging 1.00
R1544:Gm6871 UTSW 7 41546090 unclassified probably null
R1553:Gm6871 UTSW 7 41546398 missense probably benign 0.00
R1674:Gm6871 UTSW 7 41573635 missense possibly damaging 0.46
R1710:Gm6871 UTSW 7 41546477 missense probably damaging 1.00
R1743:Gm6871 UTSW 7 41546452 missense probably damaging 0.98
R1777:Gm6871 UTSW 7 41545719 missense probably benign 0.23
R1844:Gm6871 UTSW 7 41573468 missense probably benign 0.03
R2508:Gm6871 UTSW 7 41547990 missense probably benign 0.11
R2966:Gm6871 UTSW 7 41573440 missense probably benign 0.07
R3155:Gm6871 UTSW 7 41573655 missense probably benign 0.03
R3156:Gm6871 UTSW 7 41573655 missense probably benign 0.03
R4156:Gm6871 UTSW 7 41546086 missense probably damaging 0.96
R4238:Gm6871 UTSW 7 41545780 missense probably damaging 1.00
R4239:Gm6871 UTSW 7 41545780 missense probably damaging 1.00
R4240:Gm6871 UTSW 7 41545780 missense probably damaging 1.00
R4731:Gm6871 UTSW 7 41546749 missense probably benign 0.01
R4732:Gm6871 UTSW 7 41546749 missense probably benign 0.01
R4733:Gm6871 UTSW 7 41546749 missense probably benign 0.01
R4910:Gm6871 UTSW 7 41573592 missense probably benign 0.03
R5269:Gm6871 UTSW 7 41548101 missense probably damaging 0.99
R5371:Gm6871 UTSW 7 41573568 missense probably benign 0.07
R6222:Gm6871 UTSW 7 41546582 missense probably damaging 0.99
R6975:Gm6871 UTSW 7 41546778 synonymous silent
Predicted Primers PCR Primer
(F):5'- GACCACAGTAAAGTGATGTGCA -3'
(R):5'- AATGATGCGAAACAAGCCACAATG -3'

Sequencing Primer
(F):5'- GTGATGTGCAAAGGCTTTACCAC -3'
(R):5'- CACCAAGACTGTGAACAATGTG -3'
Posted On2015-04-29