Incidental Mutation 'R3967:Olfr512'
ID312392
Institutional Source Beutler Lab
Gene Symbol Olfr512
Ensembl Gene ENSMUSG00000056946
Gene Nameolfactory receptor 512
SynonymsMOR268-3, GA_x6K02T2PBJ9-11043421-11044365
MMRRC Submission 040838-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.174) question?
Stock #R3967 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location108713320-108714375 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 108713853 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 155 (M155V)
Ref Sequence ENSEMBL: ENSMUSP00000147972 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074730] [ENSMUST00000209620]
Predicted Effect probably benign
Transcript: ENSMUST00000074730
AA Change: M167V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000074291
Gene: ENSMUSG00000056946
AA Change: M167V

DomainStartEndE-ValueType
Pfam:7tm_4 43 320 7.8e-62 PFAM
Pfam:7TM_GPCR_Srsx 47 317 2.5e-6 PFAM
Pfam:7tm_1 53 302 2.3e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209620
AA Change: M155V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.2%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018B08Rik G T 8: 121,539,980 Q56K possibly damaging Het
Adam18 C A 8: 24,629,710 V518L probably benign Het
Akap6 A T 12: 53,141,453 K1883N probably damaging Het
Arhgef12 C A 9: 43,005,551 R432L probably damaging Het
Armcx6 G T X: 134,749,756 H109N possibly damaging Het
Ctnnd2 C A 15: 30,646,929 A257E possibly damaging Het
Depdc5 T A 5: 32,944,115 C322* probably null Het
Enpp7 T C 11: 118,991,001 I324T probably damaging Het
Gm14401 T C 2: 177,086,996 Y292H possibly damaging Het
Gm6871 A T 7: 41,546,724 H196Q probably damaging Het
Gm9964 T C 11: 79,296,376 T82A unknown Het
Gria2 T A 3: 80,710,777 Q317L possibly damaging Het
Grtp1 G A 8: 13,189,705 T134I probably benign Het
Itpkb A T 1: 180,327,798 probably benign Het
Kbtbd12 A G 6: 88,618,506 V114A probably benign Het
Lama3 A T 18: 12,580,341 K3230M probably damaging Het
Ly75 T C 2: 60,327,873 I1023V possibly damaging Het
Myof C T 19: 37,901,263 V1287M probably damaging Het
Myof T G 19: 38,022,610 D60A possibly damaging Het
Narf A T 11: 121,238,421 E10D possibly damaging Het
Nlrx1 A T 9: 44,255,425 probably benign Het
Olfr921 A G 9: 38,775,368 T38A probably benign Het
Pabpc5 A G X: 119,928,624 E212G probably benign Het
Pidd1 A G 7: 141,439,082 F829L possibly damaging Het
Pik3r2 G A 8: 70,770,421 R452C probably benign Het
Pkn2 A G 3: 142,809,677 C658R probably damaging Het
Psd C T 19: 46,324,406 R175H probably benign Het
Rab39 G A 9: 53,686,632 A111V possibly damaging Het
Rb1cc1 T A 1: 6,248,270 probably benign Het
Rnf39 C A 17: 36,943,143 T19K probably damaging Het
Slc16a3 C T 11: 120,955,425 T60M possibly damaging Het
Slc26a4 G T 12: 31,528,687 H656N probably damaging Het
Slc27a1 A G 8: 71,579,787 E184G probably damaging Het
Smc6 T C 12: 11,298,326 V742A probably benign Het
Thoc1 T A 18: 9,968,787 V186D probably damaging Het
Uhrf2 T C 19: 30,079,915 V491A probably damaging Het
Uri1 A G 7: 37,965,502 V253A possibly damaging Het
Vmn2r83 T A 10: 79,491,320 N587K probably benign Het
Vmn2r88 A T 14: 51,413,190 Y120F probably benign Het
Wwox G A 8: 114,488,933 A149T probably damaging Het
Zfp536 T C 7: 37,473,830 *282W probably null Het
Other mutations in Olfr512
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01889:Olfr512 APN 7 108713882 missense probably benign 0.02
IGL01912:Olfr512 APN 7 108714258 missense possibly damaging 0.60
IGL02182:Olfr512 APN 7 108713868 missense probably benign 0.02
IGL02409:Olfr512 APN 7 108714159 missense probably benign 0.00
IGL02554:Olfr512 APN 7 108713742 missense possibly damaging 0.94
IGL03210:Olfr512 APN 7 108713568 missense probably damaging 1.00
IGL03373:Olfr512 APN 7 108714132 missense probably damaging 1.00
IGL03400:Olfr512 APN 7 108713526 missense probably benign 0.28
R0092:Olfr512 UTSW 7 108713824 missense probably benign
R0741:Olfr512 UTSW 7 108713604 missense probably benign 0.00
R1515:Olfr512 UTSW 7 108713941 missense possibly damaging 0.94
R1982:Olfr512 UTSW 7 108713695 missense probably damaging 1.00
R2176:Olfr512 UTSW 7 108714132 missense probably damaging 1.00
R4009:Olfr512 UTSW 7 108714159 missense probably benign 0.00
R4010:Olfr512 UTSW 7 108714159 missense probably benign 0.00
R4011:Olfr512 UTSW 7 108714159 missense probably benign 0.00
R5095:Olfr512 UTSW 7 108713812 missense probably damaging 1.00
R5271:Olfr512 UTSW 7 108714217 missense probably damaging 1.00
R5864:Olfr512 UTSW 7 108713464 missense probably benign
R5926:Olfr512 UTSW 7 108713587 missense probably damaging 1.00
R6295:Olfr512 UTSW 7 108713638 missense probably damaging 0.98
R6528:Olfr512 UTSW 7 108713431 missense probably damaging 1.00
R6624:Olfr512 UTSW 7 108713536 missense possibly damaging 0.50
X0023:Olfr512 UTSW 7 108714010 missense possibly damaging 0.79
Z1088:Olfr512 UTSW 7 108713538 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- AGCAACCATTTCCTTTGGAGG -3'
(R):5'- CCTCAGGATGGTGAAGAGAATTCG -3'

Sequencing Primer
(F):5'- AACCATTTCCTTTGGAGGTTGTTTTG -3'
(R):5'- TGGTGAAGAGAATTCGAGTATAAGAC -3'
Posted On2015-04-29