Incidental Mutation 'R3967:Rab39'
ID312403
Institutional Source Beutler Lab
Gene Symbol Rab39
Ensembl Gene ENSMUSG00000055069
Gene NameRAB39, member RAS oncogene family
SynonymsC230094F14Rik, Rab39a
MMRRC Submission 040838-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock #R3967 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location53684110-53706232 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 53686632 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 111 (A111V)
Ref Sequence ENSEMBL: ENSMUSP00000063804 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068449]
Predicted Effect possibly damaging
Transcript: ENSMUST00000068449
AA Change: A111V

PolyPhen 2 Score 0.517 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000063804
Gene: ENSMUSG00000055069
AA Change: A111V

DomainStartEndE-ValueType
RAB 9 178 8.35e-99 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000118010
Meta Mutation Damage Score 0.252 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.2%
Validation Efficiency 100% (44/44)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018B08Rik G T 8: 121,539,980 Q56K possibly damaging Het
Adam18 C A 8: 24,629,710 V518L probably benign Het
Akap6 A T 12: 53,141,453 K1883N probably damaging Het
Arhgef12 C A 9: 43,005,551 R432L probably damaging Het
Armcx6 G T X: 134,749,756 H109N possibly damaging Het
Ctnnd2 C A 15: 30,646,929 A257E possibly damaging Het
Depdc5 T A 5: 32,944,115 C322* probably null Het
Enpp7 T C 11: 118,991,001 I324T probably damaging Het
Gm14401 T C 2: 177,086,996 Y292H possibly damaging Het
Gm6871 A T 7: 41,546,724 H196Q probably damaging Het
Gm9964 T C 11: 79,296,376 T82A unknown Het
Gria2 T A 3: 80,710,777 Q317L possibly damaging Het
Grtp1 G A 8: 13,189,705 T134I probably benign Het
Itpkb A T 1: 180,327,798 probably benign Het
Kbtbd12 A G 6: 88,618,506 V114A probably benign Het
Lama3 A T 18: 12,580,341 K3230M probably damaging Het
Ly75 T C 2: 60,327,873 I1023V possibly damaging Het
Myof C T 19: 37,901,263 V1287M probably damaging Het
Myof T G 19: 38,022,610 D60A possibly damaging Het
Narf A T 11: 121,238,421 E10D possibly damaging Het
Nlrx1 A T 9: 44,255,425 probably benign Het
Olfr512 A G 7: 108,713,853 M155V probably benign Het
Olfr921 A G 9: 38,775,368 T38A probably benign Het
Pabpc5 A G X: 119,928,624 E212G probably benign Het
Pidd1 A G 7: 141,439,082 F829L possibly damaging Het
Pik3r2 G A 8: 70,770,421 R452C probably benign Het
Pkn2 A G 3: 142,809,677 C658R probably damaging Het
Psd C T 19: 46,324,406 R175H probably benign Het
Rb1cc1 T A 1: 6,248,270 probably benign Het
Rnf39 C A 17: 36,943,143 T19K probably damaging Het
Slc16a3 C T 11: 120,955,425 T60M possibly damaging Het
Slc26a4 G T 12: 31,528,687 H656N probably damaging Het
Slc27a1 A G 8: 71,579,787 E184G probably damaging Het
Smc6 T C 12: 11,298,326 V742A probably benign Het
Thoc1 T A 18: 9,968,787 V186D probably damaging Het
Uhrf2 T C 19: 30,079,915 V491A probably damaging Het
Uri1 A G 7: 37,965,502 V253A possibly damaging Het
Vmn2r83 T A 10: 79,491,320 N587K probably benign Het
Vmn2r88 A T 14: 51,413,190 Y120F probably benign Het
Wwox G A 8: 114,488,933 A149T probably damaging Het
Zfp536 T C 7: 37,473,830 *282W probably null Het
Other mutations in Rab39
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03131:Rab39 APN 9 53686561 missense probably damaging 1.00
R0207:Rab39 UTSW 9 53705971 missense possibly damaging 0.71
R0238:Rab39 UTSW 9 53706030 missense probably damaging 0.98
R0238:Rab39 UTSW 9 53706030 missense probably damaging 0.98
R0529:Rab39 UTSW 9 53686716 missense probably damaging 1.00
R1869:Rab39 UTSW 9 53705931 missense possibly damaging 0.82
R2020:Rab39 UTSW 9 53686398 missense possibly damaging 0.78
R3968:Rab39 UTSW 9 53686632 missense possibly damaging 0.52
R3969:Rab39 UTSW 9 53686632 missense possibly damaging 0.52
R4128:Rab39 UTSW 9 53686504 missense probably benign 0.01
R4394:Rab39 UTSW 9 53686650 missense probably benign
R5173:Rab39 UTSW 9 53686500 missense probably damaging 1.00
R5839:Rab39 UTSW 9 53706087 missense probably damaging 1.00
R6351:Rab39 UTSW 9 53686521 missense probably benign
R6521:Rab39 UTSW 9 53706031 missense probably benign 0.28
R6908:Rab39 UTSW 9 53706069 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGACTCTTCAACGTTTGTCGC -3'
(R):5'- ACGGGCATGTGTTAATCTCAG -3'

Sequencing Primer
(F):5'- CAACGTTTGTCGCGTCCTTGG -3'
(R):5'- GTTACATGATATGACGGTATCTTCG -3'
Posted On2015-04-29