Incidental Mutation 'R3967:Enpp7'
ID312407
Institutional Source Beutler Lab
Gene Symbol Enpp7
Ensembl Gene ENSMUSG00000046697
Gene Nameectonucleotide pyrophosphatase/phosphodiesterase 7
SynonymsLOC238011, Alk-SMase
MMRRC Submission 040838-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3967 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location118988188-118992841 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 118991001 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 324 (I324T)
Ref Sequence ENSEMBL: ENSMUSP00000090027 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092373] [ENSMUST00000106273]
Predicted Effect probably damaging
Transcript: ENSMUST00000092373
AA Change: I324T

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000090027
Gene: ENSMUSG00000046697
AA Change: I324T

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Phosphodiest 30 353 2.5e-76 PFAM
Pfam:Metalloenzyme 43 272 8.7e-10 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000106273
AA Change: I324T

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000101880
Gene: ENSMUSG00000046697
AA Change: I324T

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Phosphodiest 30 353 3e-77 PFAM
Pfam:Metalloenzyme 41 257 5.2e-10 PFAM
Meta Mutation Damage Score 0.0236 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.2%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an intestinal alkaline sphingomyelin phosphodiesterase that converts sphingomyelin to ceramide and phosphocholine. The encoded protein is anchored in the cell membrane, and it may function to protect the intestinal mucosa from inflammation and tumorigenesis. This protein is glycosylated and also exhibits lysophosphatidylcholine hydrolase activity. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit intestinal epithelium hypertrophy, decreased crypt and villi width, and impaired sphingomyelin digestion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018B08Rik G T 8: 121,539,980 Q56K possibly damaging Het
Adam18 C A 8: 24,629,710 V518L probably benign Het
Akap6 A T 12: 53,141,453 K1883N probably damaging Het
Arhgef12 C A 9: 43,005,551 R432L probably damaging Het
Armcx6 G T X: 134,749,756 H109N possibly damaging Het
Ctnnd2 C A 15: 30,646,929 A257E possibly damaging Het
Depdc5 T A 5: 32,944,115 C322* probably null Het
Gm14401 T C 2: 177,086,996 Y292H possibly damaging Het
Gm6871 A T 7: 41,546,724 H196Q probably damaging Het
Gm9964 T C 11: 79,296,376 T82A unknown Het
Gria2 T A 3: 80,710,777 Q317L possibly damaging Het
Grtp1 G A 8: 13,189,705 T134I probably benign Het
Itpkb A T 1: 180,327,798 probably benign Het
Kbtbd12 A G 6: 88,618,506 V114A probably benign Het
Lama3 A T 18: 12,580,341 K3230M probably damaging Het
Ly75 T C 2: 60,327,873 I1023V possibly damaging Het
Myof C T 19: 37,901,263 V1287M probably damaging Het
Myof T G 19: 38,022,610 D60A possibly damaging Het
Narf A T 11: 121,238,421 E10D possibly damaging Het
Nlrx1 A T 9: 44,255,425 probably benign Het
Olfr512 A G 7: 108,713,853 M155V probably benign Het
Olfr921 A G 9: 38,775,368 T38A probably benign Het
Pabpc5 A G X: 119,928,624 E212G probably benign Het
Pidd1 A G 7: 141,439,082 F829L possibly damaging Het
Pik3r2 G A 8: 70,770,421 R452C probably benign Het
Pkn2 A G 3: 142,809,677 C658R probably damaging Het
Psd C T 19: 46,324,406 R175H probably benign Het
Rab39 G A 9: 53,686,632 A111V possibly damaging Het
Rb1cc1 T A 1: 6,248,270 probably benign Het
Rnf39 C A 17: 36,943,143 T19K probably damaging Het
Slc16a3 C T 11: 120,955,425 T60M possibly damaging Het
Slc26a4 G T 12: 31,528,687 H656N probably damaging Het
Slc27a1 A G 8: 71,579,787 E184G probably damaging Het
Smc6 T C 12: 11,298,326 V742A probably benign Het
Thoc1 T A 18: 9,968,787 V186D probably damaging Het
Uhrf2 T C 19: 30,079,915 V491A probably damaging Het
Uri1 A G 7: 37,965,502 V253A possibly damaging Het
Vmn2r83 T A 10: 79,491,320 N587K probably benign Het
Vmn2r88 A T 14: 51,413,190 Y120F probably benign Het
Wwox G A 8: 114,488,933 A149T probably damaging Het
Zfp536 T C 7: 37,473,830 *282W probably null Het
Other mutations in Enpp7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00793:Enpp7 APN 11 118990545 missense probably damaging 1.00
IGL02488:Enpp7 APN 11 118988814 missense probably damaging 1.00
IGL02672:Enpp7 APN 11 118992340 critical splice donor site probably null
R0465:Enpp7 UTSW 11 118988781 missense probably damaging 1.00
R1718:Enpp7 UTSW 11 118990983 missense probably damaging 1.00
R2208:Enpp7 UTSW 11 118988762 splice site probably benign
R2970:Enpp7 UTSW 11 118990646 missense probably damaging 1.00
R3713:Enpp7 UTSW 11 118990518 missense probably damaging 1.00
R5222:Enpp7 UTSW 11 118990962 missense probably benign 0.03
R5454:Enpp7 UTSW 11 118988808 missense probably benign 0.03
R5577:Enpp7 UTSW 11 118992127 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCTTCCAGGACATCCAGTTTG -3'
(R):5'- CCTTGAGCCTGGGATTCCC -3'

Sequencing Primer
(F):5'- TCCAGGACATCCAGTTTGAGCTG -3'
(R):5'- TACCATACACACACTCTGTCTG -3'
Posted On2015-04-29