Incidental Mutation 'R3967:Slc26a4'
ID312411
Institutional Source Beutler Lab
Gene Symbol Slc26a4
Ensembl Gene ENSMUSG00000020651
Gene Namesolute carrier family 26, member 4
SynonymsPds, pendrin
MMRRC Submission 040838-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3967 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location31519827-31559969 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 31528687 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Asparagine at position 656 (H656N)
Ref Sequence ENSEMBL: ENSMUSP00000001253 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001253]
Predicted Effect probably damaging
Transcript: ENSMUST00000001253
AA Change: H656N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000001253
Gene: ENSMUSG00000020651
AA Change: H656N

DomainStartEndE-ValueType
low complexity region 33 47 N/A INTRINSIC
Pfam:Sulfate_transp 84 485 1e-105 PFAM
low complexity region 492 507 N/A INTRINSIC
Pfam:STAS 536 725 1.4e-42 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218992
Meta Mutation Damage Score 0.088 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.2%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mutations in this gene are associated with Pendred syndrome, the most common form of syndromic deafness, an autosomal-recessive disease. It is highly homologous to the SLC26A3 gene; they have similar genomic structures and this gene is located 3' of the SLC26A3 gene. The encoded protein has homology to sulfate transporters. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants are completely deaf with vestibular dysfunction. Mutants show endolymphatic dilatation, degeneration of sensory cells and malformations of otoconia and otoconial membranes. They display unsteady gait and circling and head bobbing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018B08Rik G T 8: 121,539,980 Q56K possibly damaging Het
Adam18 C A 8: 24,629,710 V518L probably benign Het
Akap6 A T 12: 53,141,453 K1883N probably damaging Het
Arhgef12 C A 9: 43,005,551 R432L probably damaging Het
Armcx6 G T X: 134,749,756 H109N possibly damaging Het
Ctnnd2 C A 15: 30,646,929 A257E possibly damaging Het
Depdc5 T A 5: 32,944,115 C322* probably null Het
Enpp7 T C 11: 118,991,001 I324T probably damaging Het
Gm14401 T C 2: 177,086,996 Y292H possibly damaging Het
Gm6871 A T 7: 41,546,724 H196Q probably damaging Het
Gm9964 T C 11: 79,296,376 T82A unknown Het
Gria2 T A 3: 80,710,777 Q317L possibly damaging Het
Grtp1 G A 8: 13,189,705 T134I probably benign Het
Itpkb A T 1: 180,327,798 probably benign Het
Kbtbd12 A G 6: 88,618,506 V114A probably benign Het
Lama3 A T 18: 12,580,341 K3230M probably damaging Het
Ly75 T C 2: 60,327,873 I1023V possibly damaging Het
Myof C T 19: 37,901,263 V1287M probably damaging Het
Myof T G 19: 38,022,610 D60A possibly damaging Het
Narf A T 11: 121,238,421 E10D possibly damaging Het
Nlrx1 A T 9: 44,255,425 probably benign Het
Olfr512 A G 7: 108,713,853 M155V probably benign Het
Olfr921 A G 9: 38,775,368 T38A probably benign Het
Pabpc5 A G X: 119,928,624 E212G probably benign Het
Pidd1 A G 7: 141,439,082 F829L possibly damaging Het
Pik3r2 G A 8: 70,770,421 R452C probably benign Het
Pkn2 A G 3: 142,809,677 C658R probably damaging Het
Psd C T 19: 46,324,406 R175H probably benign Het
Rab39 G A 9: 53,686,632 A111V possibly damaging Het
Rb1cc1 T A 1: 6,248,270 probably benign Het
Rnf39 C A 17: 36,943,143 T19K probably damaging Het
Slc16a3 C T 11: 120,955,425 T60M possibly damaging Het
Slc27a1 A G 8: 71,579,787 E184G probably damaging Het
Smc6 T C 12: 11,298,326 V742A probably benign Het
Thoc1 T A 18: 9,968,787 V186D probably damaging Het
Uhrf2 T C 19: 30,079,915 V491A probably damaging Het
Uri1 A G 7: 37,965,502 V253A possibly damaging Het
Vmn2r83 T A 10: 79,491,320 N587K probably benign Het
Vmn2r88 A T 14: 51,413,190 Y120F probably benign Het
Wwox G A 8: 114,488,933 A149T probably damaging Het
Zfp536 T C 7: 37,473,830 *282W probably null Het
Other mutations in Slc26a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01754:Slc26a4 APN 12 31528854 splice site probably benign
IGL01763:Slc26a4 APN 12 31528854 splice site probably benign
IGL01778:Slc26a4 APN 12 31528854 splice site probably benign
IGL01779:Slc26a4 APN 12 31528854 splice site probably benign
IGL01872:Slc26a4 APN 12 31539203 missense probably benign 0.22
IGL02016:Slc26a4 APN 12 31535667 missense probably damaging 0.99
IGL02184:Slc26a4 APN 12 31549949 missense probably damaging 1.00
IGL02267:Slc26a4 APN 12 31528854 splice site probably benign
IGL02270:Slc26a4 APN 12 31528854 splice site probably benign
IGL02271:Slc26a4 APN 12 31528854 splice site probably benign
IGL02347:Slc26a4 APN 12 31528854 splice site probably benign
IGL02543:Slc26a4 APN 12 31528689 missense possibly damaging 0.75
IGL02803:Slc26a4 APN 12 31522527 critical splice acceptor site probably null
IGL02885:Slc26a4 APN 12 31525476 missense probably benign 0.00
IGL02974:Slc26a4 APN 12 31529554 missense probably damaging 1.00
IGL03037:Slc26a4 APN 12 31531687 splice site probably benign
cul-de-sac UTSW 12 31525568 nonsense probably null
discobolus UTSW 12 31540533 nonsense probably null
R0152:Slc26a4 UTSW 12 31529498 missense probably damaging 1.00
R0677:Slc26a4 UTSW 12 31549911 critical splice donor site probably null
R0961:Slc26a4 UTSW 12 31535619 missense probably benign
R1025:Slc26a4 UTSW 12 31528737 missense probably damaging 1.00
R1301:Slc26a4 UTSW 12 31525568 nonsense probably null
R1729:Slc26a4 UTSW 12 31544494 missense possibly damaging 0.95
R2321:Slc26a4 UTSW 12 31540544 missense probably damaging 1.00
R3970:Slc26a4 UTSW 12 31528687 missense probably damaging 1.00
R4007:Slc26a4 UTSW 12 31540533 nonsense probably null
R4370:Slc26a4 UTSW 12 31529476 missense probably benign 0.01
R4647:Slc26a4 UTSW 12 31540526 missense possibly damaging 0.90
R4648:Slc26a4 UTSW 12 31540526 missense possibly damaging 0.90
R5816:Slc26a4 UTSW 12 31528685 missense probably damaging 1.00
R5932:Slc26a4 UTSW 12 31535249 critical splice donor site probably null
R6675:Slc26a4 UTSW 12 31540513 missense possibly damaging 0.89
R6732:Slc26a4 UTSW 12 31526600 critical splice donor site probably null
R6890:Slc26a4 UTSW 12 31549951 missense possibly damaging 0.79
X0022:Slc26a4 UTSW 12 31535687 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCACGGTCCATTTATGTTCTTAG -3'
(R):5'- ATTGACAAGTAAGTCCGAGGTG -3'

Sequencing Primer
(F):5'- AGCCTGACTGCAGAGCTTATG -3'
(R):5'- ACAAGTAAGTCCGAGGTGTTTTC -3'
Posted On2015-04-29