Incidental Mutation 'R3967:Uhrf2'
ID312417
Institutional Source Beutler Lab
Gene Symbol Uhrf2
Ensembl Gene ENSMUSG00000024817
Gene Nameubiquitin-like, containing PHD and RING finger domains 2
SynonymsNirf, D130071B19Rik, 2310065A22Rik
MMRRC Submission 040838-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.777) question?
Stock #R3967 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location30030513-30093722 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 30079915 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 491 (V491A)
Ref Sequence ENSEMBL: ENSMUSP00000025739 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025739]
Predicted Effect probably damaging
Transcript: ENSMUST00000025739
AA Change: V491A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025739
Gene: ENSMUSG00000024817
AA Change: V491A

DomainStartEndE-ValueType
UBQ 1 74 8.95e-7 SMART
Pfam:TTD 125 313 2.2e-66 PFAM
PHD 347 394 9.54e-11 SMART
RING 348 393 1.38e0 SMART
SRA 444 617 2.82e-77 SMART
low complexity region 644 661 N/A INTRINSIC
RING 734 772 3.67e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129420
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137368
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150532
Meta Mutation Damage Score 0.416 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.2%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein which is involved in cell-cycle regulation. The encoded protein is a ubiquitin-ligase capable of ubiquinating PCNP (PEST-containing nuclear protein), and together they may play a role in tumorigenesis. The encoded protein contains an NIRF_N domain, a PHD finger, a set- and ring-associated (SRA) domain, and a RING finger domain and several of these domains have been shown to be essential for the regulation of cell proliferation. This protein may also have a role in intranuclear degradation of polyglutamine aggregates. Alternative splicing results in multiple transcript variants some of which are non-protein coding. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous KO causes deregulated expression of neuron-related genes, reduced DNA methylation in the brain and impaired contextual conditioning and spatial memory. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018B08Rik G T 8: 121,539,980 Q56K possibly damaging Het
Adam18 C A 8: 24,629,710 V518L probably benign Het
Akap6 A T 12: 53,141,453 K1883N probably damaging Het
Arhgef12 C A 9: 43,005,551 R432L probably damaging Het
Armcx6 G T X: 134,749,756 H109N possibly damaging Het
Ctnnd2 C A 15: 30,646,929 A257E possibly damaging Het
Depdc5 T A 5: 32,944,115 C322* probably null Het
Enpp7 T C 11: 118,991,001 I324T probably damaging Het
Gm14401 T C 2: 177,086,996 Y292H possibly damaging Het
Gm6871 A T 7: 41,546,724 H196Q probably damaging Het
Gm9964 T C 11: 79,296,376 T82A unknown Het
Gria2 T A 3: 80,710,777 Q317L possibly damaging Het
Grtp1 G A 8: 13,189,705 T134I probably benign Het
Itpkb A T 1: 180,327,798 probably benign Het
Kbtbd12 A G 6: 88,618,506 V114A probably benign Het
Lama3 A T 18: 12,580,341 K3230M probably damaging Het
Ly75 T C 2: 60,327,873 I1023V possibly damaging Het
Myof C T 19: 37,901,263 V1287M probably damaging Het
Myof T G 19: 38,022,610 D60A possibly damaging Het
Narf A T 11: 121,238,421 E10D possibly damaging Het
Nlrx1 A T 9: 44,255,425 probably benign Het
Olfr512 A G 7: 108,713,853 M155V probably benign Het
Olfr921 A G 9: 38,775,368 T38A probably benign Het
Pabpc5 A G X: 119,928,624 E212G probably benign Het
Pidd1 A G 7: 141,439,082 F829L possibly damaging Het
Pik3r2 G A 8: 70,770,421 R452C probably benign Het
Pkn2 A G 3: 142,809,677 C658R probably damaging Het
Psd C T 19: 46,324,406 R175H probably benign Het
Rab39 G A 9: 53,686,632 A111V possibly damaging Het
Rb1cc1 T A 1: 6,248,270 probably benign Het
Rnf39 C A 17: 36,943,143 T19K probably damaging Het
Slc16a3 C T 11: 120,955,425 T60M possibly damaging Het
Slc26a4 G T 12: 31,528,687 H656N probably damaging Het
Slc27a1 A G 8: 71,579,787 E184G probably damaging Het
Smc6 T C 12: 11,298,326 V742A probably benign Het
Thoc1 T A 18: 9,968,787 V186D probably damaging Het
Uri1 A G 7: 37,965,502 V253A possibly damaging Het
Vmn2r83 T A 10: 79,491,320 N587K probably benign Het
Vmn2r88 A T 14: 51,413,190 Y120F probably benign Het
Wwox G A 8: 114,488,933 A149T probably damaging Het
Zfp536 T C 7: 37,473,830 *282W probably null Het
Other mutations in Uhrf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Uhrf2 APN 19 30073946 missense probably benign 0.03
IGL01290:Uhrf2 APN 19 30039301 splice site probably benign
IGL01599:Uhrf2 APN 19 30092120 missense probably damaging 1.00
IGL01724:Uhrf2 APN 19 30075252 missense probably benign 0.29
IGL01861:Uhrf2 APN 19 30086404 missense probably damaging 1.00
IGL02182:Uhrf2 APN 19 30039209 missense probably benign
IGL02673:Uhrf2 APN 19 30092807 missense probably damaging 1.00
R0502:Uhrf2 UTSW 19 30092776 missense probably damaging 1.00
R1136:Uhrf2 UTSW 19 30056226 splice site probably benign
R1510:Uhrf2 UTSW 19 30039061 splice site probably benign
R2110:Uhrf2 UTSW 19 30056488 missense probably damaging 1.00
R3760:Uhrf2 UTSW 19 30073931 missense probably benign 0.20
R3951:Uhrf2 UTSW 19 30079861 missense probably damaging 1.00
R3970:Uhrf2 UTSW 19 30079915 missense probably damaging 1.00
R5129:Uhrf2 UTSW 19 30075221 missense probably benign 0.00
R5568:Uhrf2 UTSW 19 30039088 missense probably damaging 1.00
R5875:Uhrf2 UTSW 19 30089302 missense probably damaging 1.00
X0020:Uhrf2 UTSW 19 30089345 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GCATATTGTAAGTGACTCCATTGG -3'
(R):5'- GTGGACTGCAGCTTTATCCATATC -3'

Sequencing Primer
(F):5'- TGTAAGTGACTCCATTGGTACTC -3'
(R):5'- TACTGTGAAACTACAAAAATAGGCC -3'
Posted On2015-04-29