Incidental Mutation 'R3968:Pecr'
ID312423
Institutional Source Beutler Lab
Gene Symbol Pecr
Ensembl Gene ENSMUSG00000026189
Gene Nameperoxisomal trans-2-enoyl-CoA reductase
Synonyms
MMRRC Submission 040936-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.120) question?
Stock #R3968 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location72259167-72284314 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 72276309 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 94 (T94I)
Ref Sequence ENSEMBL: ENSMUSP00000027381 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027381] [ENSMUST00000097698] [ENSMUST00000129458] [ENSMUST00000134840]
Predicted Effect probably damaging
Transcript: ENSMUST00000027381
AA Change: T94I

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000027381
Gene: ENSMUSG00000026189
AA Change: T94I

DomainStartEndE-ValueType
Pfam:adh_short 19 216 5e-47 PFAM
Pfam:KR 20 148 2.3e-10 PFAM
Pfam:adh_short_C2 25 266 4.1e-29 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000097698
AA Change: T94I

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000095304
Gene: ENSMUSG00000026189
AA Change: T94I

DomainStartEndE-ValueType
Pfam:adh_short 19 190 5.8e-26 PFAM
Pfam:KR 20 148 9.3e-12 PFAM
Pfam:adh_short_C2 25 242 8.7e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129458
Predicted Effect probably benign
Transcript: ENSMUST00000134840
SMART Domains Protein: ENSMUSP00000120890
Gene: ENSMUSG00000026189

DomainStartEndE-ValueType
Pfam:adh_short 19 89 1.7e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180722
Meta Mutation Damage Score 0.162 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.1%
Validation Efficiency 98% (40/41)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef12 C A 9: 43,005,551 R432L probably damaging Het
Camk4 T A 18: 33,179,581 I258N possibly damaging Het
Cdhr2 A T 13: 54,726,458 N781I probably damaging Het
Cela1 C T 15: 100,684,653 G93S probably damaging Het
Commd9 C A 2: 101,897,141 N93K probably benign Het
Cysltr2 A G 14: 73,030,174 I32T probably damaging Het
E2f1 C G 2: 154,564,022 G144R probably damaging Het
Fcho2 A T 13: 98,735,056 S551T probably benign Het
Fzd8 T C 18: 9,214,070 V384A probably damaging Het
Gm14401 T C 2: 177,086,996 Y292H possibly damaging Het
H2-M2 C T 17: 37,481,306 G318S possibly damaging Het
Il21r G T 7: 125,628,043 probably null Het
Itgam T C 7: 128,113,033 Y697H probably damaging Het
Itpkb A T 1: 180,327,798 probably benign Het
Lama3 A T 18: 12,580,341 K3230M probably damaging Het
Ly75 T C 2: 60,327,873 I1023V possibly damaging Het
Narf A T 11: 121,238,421 E10D possibly damaging Het
Net1 A G 13: 3,907,795 probably null Het
Nlrx1 A T 9: 44,255,425 probably benign Het
Oard1 T C 17: 48,415,254 Y93H probably damaging Het
Olfr722 A T 14: 49,895,526 I92N probably damaging Het
Olfr921 A G 9: 38,775,368 T38A probably benign Het
Pcm1 T C 8: 41,325,830 L1825P probably damaging Het
Piezo2 A T 18: 63,011,696 V2776E probably damaging Het
Pik3r2 G A 8: 70,770,421 R452C probably benign Het
Ppfia2 T A 10: 106,906,521 D1058E probably damaging Het
Ppl T C 16: 5,100,332 probably null Het
Rab39 G A 9: 53,686,632 A111V possibly damaging Het
Sema3g T C 14: 31,226,521 probably null Het
Slc19a1 T C 10: 77,041,846 Y72H probably damaging Het
Sntb2 T A 8: 106,997,140 Y340* probably null Het
Srrm4 A G 5: 116,444,744 probably benign Het
Ssb C T 2: 69,867,449 probably benign Het
Sval2 T A 6: 41,861,927 V14E probably damaging Het
Tmc2 T G 2: 130,202,071 V75G probably benign Het
Tnnc2 T C 2: 164,777,537 E129G possibly damaging Het
Vmn2r94 C A 17: 18,258,385 Q33H possibly damaging Het
Yap1 C T 9: 7,973,876 R188Q probably damaging Het
Other mutations in Pecr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03124:Pecr APN 1 72277340 missense probably benign 0.04
R1556:Pecr UTSW 1 72259383 missense probably benign
R1711:Pecr UTSW 1 72277409 missense possibly damaging 0.93
R1882:Pecr UTSW 1 72274977 splice site probably null
R2150:Pecr UTSW 1 72277358 missense possibly damaging 0.73
R2507:Pecr UTSW 1 72261976 missense probably benign 0.11
R2516:Pecr UTSW 1 72277310 missense probably damaging 1.00
R3774:Pecr UTSW 1 72259371 missense probably benign 0.00
R3775:Pecr UTSW 1 72259371 missense probably benign 0.00
R3969:Pecr UTSW 1 72276309 missense probably damaging 0.99
R3970:Pecr UTSW 1 72276309 missense probably damaging 0.99
R4171:Pecr UTSW 1 72276269 missense probably damaging 1.00
R4773:Pecr UTSW 1 72267435 missense probably damaging 1.00
R4864:Pecr UTSW 1 72277331 missense probably benign 0.35
R5191:Pecr UTSW 1 72274977 splice site probably null
R5259:Pecr UTSW 1 72277285 critical splice donor site probably null
R5331:Pecr UTSW 1 72274846 intron probably benign
R6828:Pecr UTSW 1 72267457 nonsense probably null
R7238:Pecr UTSW 1 72259433 missense probably damaging 0.99
R7358:Pecr UTSW 1 72267465 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCTCTTACTGAAGCCATGCTG -3'
(R):5'- ATTCACACTGTGGGATCTGGG -3'

Sequencing Primer
(F):5'- TGGAACTCACTCTGTAGACCAGG -3'
(R):5'- ACTGTGGGATCTGGGGGTTTATTC -3'
Posted On2015-04-29