Incidental Mutation 'R3968:Commd9'
ID312427
Institutional Source Beutler Lab
Gene Symbol Commd9
Ensembl Gene ENSMUSG00000027163
Gene NameCOMM domain containing 9
Synonyms1810029F08Rik
MMRRC Submission 040936-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3968 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location101886247-101901646 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 101897141 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 93 (N93K)
Ref Sequence ENSEMBL: ENSMUSP00000028584 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028584]
Predicted Effect probably benign
Transcript: ENSMUST00000028584
AA Change: N93K

PolyPhen 2 Score 0.180 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000028584
Gene: ENSMUSG00000027163
AA Change: N93K

DomainStartEndE-ValueType
Pfam:HCaRG 15 194 9e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131287
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133576
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156799
Meta Mutation Damage Score 0.472 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.1%
Validation Efficiency 98% (40/41)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality, neural tube edema, and cardiovascular abnormalities including hemorrhages, heart hypoplasia, focal myocardial wall necrosis and narrowing of the dorsal aortas, and alterations in cranial blood vessels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef12 C A 9: 43,005,551 R432L probably damaging Het
Camk4 T A 18: 33,179,581 I258N possibly damaging Het
Cdhr2 A T 13: 54,726,458 N781I probably damaging Het
Cela1 C T 15: 100,684,653 G93S probably damaging Het
Cysltr2 A G 14: 73,030,174 I32T probably damaging Het
E2f1 C G 2: 154,564,022 G144R probably damaging Het
Fcho2 A T 13: 98,735,056 S551T probably benign Het
Fzd8 T C 18: 9,214,070 V384A probably damaging Het
Gm14401 T C 2: 177,086,996 Y292H possibly damaging Het
H2-M2 C T 17: 37,481,306 G318S possibly damaging Het
Il21r G T 7: 125,628,043 probably null Het
Itgam T C 7: 128,113,033 Y697H probably damaging Het
Itpkb A T 1: 180,327,798 probably benign Het
Lama3 A T 18: 12,580,341 K3230M probably damaging Het
Ly75 T C 2: 60,327,873 I1023V possibly damaging Het
Narf A T 11: 121,238,421 E10D possibly damaging Het
Net1 A G 13: 3,907,795 probably null Het
Nlrx1 A T 9: 44,255,425 probably benign Het
Oard1 T C 17: 48,415,254 Y93H probably damaging Het
Olfr722 A T 14: 49,895,526 I92N probably damaging Het
Olfr921 A G 9: 38,775,368 T38A probably benign Het
Pcm1 T C 8: 41,325,830 L1825P probably damaging Het
Pecr G A 1: 72,276,309 T94I probably damaging Het
Piezo2 A T 18: 63,011,696 V2776E probably damaging Het
Pik3r2 G A 8: 70,770,421 R452C probably benign Het
Ppfia2 T A 10: 106,906,521 D1058E probably damaging Het
Ppl T C 16: 5,100,332 probably null Het
Rab39 G A 9: 53,686,632 A111V possibly damaging Het
Sema3g T C 14: 31,226,521 probably null Het
Slc19a1 T C 10: 77,041,846 Y72H probably damaging Het
Sntb2 T A 8: 106,997,140 Y340* probably null Het
Srrm4 A G 5: 116,444,744 probably benign Het
Ssb C T 2: 69,867,449 probably benign Het
Sval2 T A 6: 41,861,927 V14E probably damaging Het
Tmc2 T G 2: 130,202,071 V75G probably benign Het
Tnnc2 T C 2: 164,777,537 E129G possibly damaging Het
Vmn2r94 C A 17: 18,258,385 Q33H possibly damaging Het
Yap1 C T 9: 7,973,876 R188Q probably damaging Het
Other mutations in Commd9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00475:Commd9 APN 2 101895156 nonsense probably null
IGL02232:Commd9 APN 2 101900979 missense probably benign 0.34
IGL03109:Commd9 APN 2 101897170 missense probably benign
R1873:Commd9 UTSW 2 101897157 missense probably benign 0.09
R1933:Commd9 UTSW 2 101901031 missense probably damaging 1.00
R3826:Commd9 UTSW 2 101897141 missense probably benign 0.18
R3828:Commd9 UTSW 2 101897141 missense probably benign 0.18
R3829:Commd9 UTSW 2 101897141 missense probably benign 0.18
R3969:Commd9 UTSW 2 101897141 missense probably benign 0.18
R3970:Commd9 UTSW 2 101897141 missense probably benign 0.18
R4059:Commd9 UTSW 2 101895154 missense possibly damaging 0.93
R4795:Commd9 UTSW 2 101898896 missense probably benign 0.00
R5289:Commd9 UTSW 2 101898894 missense probably benign 0.00
R5426:Commd9 UTSW 2 101898875 missense probably damaging 1.00
R5437:Commd9 UTSW 2 101901028 missense probably damaging 1.00
R7209:Commd9 UTSW 2 101895138 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GTGAGTGTACAGAGCTCCAC -3'
(R):5'- AGGGATGAACAGCTTTCCATTAAG -3'

Sequencing Primer
(F):5'- TGTACAGAGCTCCACCCCTG -3'
(R):5'- CCATTAAGGCAATTAAGCTCTGGGTG -3'
Posted On2015-04-29