Incidental Mutation 'R3968:Sval2'
ID312435
Institutional Source Beutler Lab
Gene Symbol Sval2
Ensembl Gene ENSMUSG00000014104
Gene Nameseminal vesicle antigen-like 2
SynonymsSLP-M
MMRRC Submission 040936-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R3968 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location41852989-41864413 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 41861927 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 14 (V14E)
Ref Sequence ENSEMBL: ENSMUSP00000113417 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014248] [ENSMUST00000119995] [ENSMUST00000120605]
Predicted Effect probably damaging
Transcript: ENSMUST00000014248
AA Change: V53E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000014248
Gene: ENSMUSG00000014104
AA Change: V53E

DomainStartEndE-ValueType
Pfam:SVA 3 124 6.8e-53 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000119995
AA Change: V33E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113701
Gene: ENSMUSG00000014104
AA Change: V33E

DomainStartEndE-ValueType
Pfam:SVA 9 104 5.4e-39 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000120605
AA Change: V14E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113417
Gene: ENSMUSG00000014104
AA Change: V14E

DomainStartEndE-ValueType
Pfam:SVA 1 85 1.4e-35 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143093
Meta Mutation Damage Score 0.0308 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.1%
Validation Efficiency 98% (40/41)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef12 C A 9: 43,005,551 R432L probably damaging Het
Camk4 T A 18: 33,179,581 I258N possibly damaging Het
Cdhr2 A T 13: 54,726,458 N781I probably damaging Het
Cela1 C T 15: 100,684,653 G93S probably damaging Het
Commd9 C A 2: 101,897,141 N93K probably benign Het
Cysltr2 A G 14: 73,030,174 I32T probably damaging Het
E2f1 C G 2: 154,564,022 G144R probably damaging Het
Fcho2 A T 13: 98,735,056 S551T probably benign Het
Fzd8 T C 18: 9,214,070 V384A probably damaging Het
Gm14401 T C 2: 177,086,996 Y292H possibly damaging Het
H2-M2 C T 17: 37,481,306 G318S possibly damaging Het
Il21r G T 7: 125,628,043 probably null Het
Itgam T C 7: 128,113,033 Y697H probably damaging Het
Itpkb A T 1: 180,327,798 probably benign Het
Lama3 A T 18: 12,580,341 K3230M probably damaging Het
Ly75 T C 2: 60,327,873 I1023V possibly damaging Het
Narf A T 11: 121,238,421 E10D possibly damaging Het
Net1 A G 13: 3,907,795 probably null Het
Nlrx1 A T 9: 44,255,425 probably benign Het
Oard1 T C 17: 48,415,254 Y93H probably damaging Het
Olfr722 A T 14: 49,895,526 I92N probably damaging Het
Olfr921 A G 9: 38,775,368 T38A probably benign Het
Pcm1 T C 8: 41,325,830 L1825P probably damaging Het
Pecr G A 1: 72,276,309 T94I probably damaging Het
Piezo2 A T 18: 63,011,696 V2776E probably damaging Het
Pik3r2 G A 8: 70,770,421 R452C probably benign Het
Ppfia2 T A 10: 106,906,521 D1058E probably damaging Het
Ppl T C 16: 5,100,332 probably null Het
Rab39 G A 9: 53,686,632 A111V possibly damaging Het
Sema3g T C 14: 31,226,521 probably null Het
Slc19a1 T C 10: 77,041,846 Y72H probably damaging Het
Sntb2 T A 8: 106,997,140 Y340* probably null Het
Srrm4 A G 5: 116,444,744 probably benign Het
Ssb C T 2: 69,867,449 probably benign Het
Tmc2 T G 2: 130,202,071 V75G probably benign Het
Tnnc2 T C 2: 164,777,537 E129G possibly damaging Het
Vmn2r94 C A 17: 18,258,385 Q33H possibly damaging Het
Yap1 C T 9: 7,973,876 R188Q probably damaging Het
Other mutations in Sval2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02793:Sval2 APN 6 41861861 missense probably benign 0.00
IGL03338:Sval2 APN 6 41864247 missense probably damaging 1.00
R1224:Sval2 UTSW 6 41864254 missense probably benign 0.02
R1912:Sval2 UTSW 6 41864320 makesense probably null
R4238:Sval2 UTSW 6 41860349 missense probably damaging 1.00
R5138:Sval2 UTSW 6 41861945 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATCTTGCTGACACTTGATACCTAG -3'
(R):5'- CCTGTGAAGACCCTCAGATC -3'

Sequencing Primer
(F):5'- GACACTTGATACCTAGAGCTCTG -3'
(R):5'- AGGGTAGACTTTGTAAAACATGC -3'
Posted On2015-04-29