Incidental Mutation 'R3968:Pcm1'
ID312438
Institutional Source Beutler Lab
Gene Symbol Pcm1
Ensembl Gene ENSMUSG00000031592
Gene Namepericentriolar material 1
Synonyms9430077F19Rik, 2600002H09Rik, C030044G17Rik
MMRRC Submission 040936-MU
Accession Numbers

Genbank: NM_023662; MGI: 1277958

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3968 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location41239752-41332344 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 41325830 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 1825 (L1825P)
Ref Sequence ENSEMBL: ENSMUSP00000147887 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045218] [ENSMUST00000211247]
Predicted Effect probably damaging
Transcript: ENSMUST00000045218
AA Change: L1786P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000039709
Gene: ENSMUSG00000031592
AA Change: L1786P

DomainStartEndE-ValueType
coiled coil region 218 238 N/A INTRINSIC
coiled coil region 270 301 N/A INTRINSIC
coiled coil region 399 426 N/A INTRINSIC
coiled coil region 492 520 N/A INTRINSIC
low complexity region 527 548 N/A INTRINSIC
low complexity region 622 647 N/A INTRINSIC
coiled coil region 652 683 N/A INTRINSIC
coiled coil region 724 772 N/A INTRINSIC
coiled coil region 822 856 N/A INTRINSIC
coiled coil region 988 1017 N/A INTRINSIC
low complexity region 1021 1033 N/A INTRINSIC
low complexity region 1287 1301 N/A INTRINSIC
Pfam:PCM1_C 1369 1999 3.6e-295 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000211247
AA Change: L1825P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.0336 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.1%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of centriolar satellites, which are electron dense granules scattered around centrosomes. Inhibition studies show that this protein is essential for the correct localization of several centrosomal proteins, and for anchoring microtubules to the centrosome. Chromosomal aberrations involving this gene are associated with papillary thyroid carcinomas and a variety of hematological malignancies, including atypical chronic myeloid leukemia and T-cell lymphoma. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2015]
Allele List at MGI

All alleles(34) : Gene trapped(34)

Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef12 C A 9: 43,005,551 R432L probably damaging Het
Camk4 T A 18: 33,179,581 I258N possibly damaging Het
Cdhr2 A T 13: 54,726,458 N781I probably damaging Het
Cela1 C T 15: 100,684,653 G93S probably damaging Het
Commd9 C A 2: 101,897,141 N93K probably benign Het
Cysltr2 A G 14: 73,030,174 I32T probably damaging Het
E2f1 C G 2: 154,564,022 G144R probably damaging Het
Fcho2 A T 13: 98,735,056 S551T probably benign Het
Fzd8 T C 18: 9,214,070 V384A probably damaging Het
Gm14401 T C 2: 177,086,996 Y292H possibly damaging Het
H2-M2 C T 17: 37,481,306 G318S possibly damaging Het
Il21r G T 7: 125,628,043 probably null Het
Itgam T C 7: 128,113,033 Y697H probably damaging Het
Itpkb A T 1: 180,327,798 probably benign Het
Lama3 A T 18: 12,580,341 K3230M probably damaging Het
Ly75 T C 2: 60,327,873 I1023V possibly damaging Het
Narf A T 11: 121,238,421 E10D possibly damaging Het
Net1 A G 13: 3,907,795 probably null Het
Nlrx1 A T 9: 44,255,425 probably benign Het
Oard1 T C 17: 48,415,254 Y93H probably damaging Het
Olfr722 A T 14: 49,895,526 I92N probably damaging Het
Olfr921 A G 9: 38,775,368 T38A probably benign Het
Pecr G A 1: 72,276,309 T94I probably damaging Het
Piezo2 A T 18: 63,011,696 V2776E probably damaging Het
Pik3r2 G A 8: 70,770,421 R452C probably benign Het
Ppfia2 T A 10: 106,906,521 D1058E probably damaging Het
Ppl T C 16: 5,100,332 probably null Het
Rab39 G A 9: 53,686,632 A111V possibly damaging Het
Sema3g T C 14: 31,226,521 probably null Het
Slc19a1 T C 10: 77,041,846 Y72H probably damaging Het
Sntb2 T A 8: 106,997,140 Y340* probably null Het
Srrm4 A G 5: 116,444,744 probably benign Het
Ssb C T 2: 69,867,449 probably benign Het
Sval2 T A 6: 41,861,927 V14E probably damaging Het
Tmc2 T G 2: 130,202,071 V75G probably benign Het
Tnnc2 T C 2: 164,777,537 E129G possibly damaging Het
Vmn2r94 C A 17: 18,258,385 Q33H possibly damaging Het
Yap1 C T 9: 7,973,876 R188Q probably damaging Het
Other mutations in Pcm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00773:Pcm1 APN 8 41274277 missense probably damaging 1.00
IGL00852:Pcm1 APN 8 41287821 missense probably damaging 1.00
IGL00896:Pcm1 APN 8 41276123 missense possibly damaging 0.70
IGL00927:Pcm1 APN 8 41287881 missense probably damaging 1.00
IGL01085:Pcm1 APN 8 41309603 missense probably damaging 1.00
IGL01684:Pcm1 APN 8 41257923 missense probably benign 0.00
IGL01888:Pcm1 APN 8 41257956 missense probably damaging 0.98
IGL02349:Pcm1 APN 8 41288155 critical splice donor site probably null
IGL02562:Pcm1 APN 8 41325368 missense probably damaging 1.00
IGL02807:Pcm1 APN 8 41330882 missense probably damaging 1.00
IGL03081:Pcm1 APN 8 41275060 missense probably damaging 1.00
shaved UTSW 8 41288156 critical splice donor site probably null
D3080:Pcm1 UTSW 8 41275939 missense probably damaging 1.00
P0045:Pcm1 UTSW 8 41288097 missense probably damaging 0.99
R0090:Pcm1 UTSW 8 41256041 missense probably damaging 0.99
R0109:Pcm1 UTSW 8 41257937 missense possibly damaging 0.88
R0373:Pcm1 UTSW 8 41276111 nonsense probably null
R0386:Pcm1 UTSW 8 41316023 missense probably damaging 1.00
R0452:Pcm1 UTSW 8 41325905 missense probably benign 0.25
R0498:Pcm1 UTSW 8 41293769 missense probably benign 0.01
R0528:Pcm1 UTSW 8 41315930 missense probably damaging 1.00
R0587:Pcm1 UTSW 8 41286051 missense probably damaging 0.99
R0635:Pcm1 UTSW 8 41267179 splice site probably benign
R0725:Pcm1 UTSW 8 41287811 missense probably damaging 1.00
R0762:Pcm1 UTSW 8 41261020 missense probably damaging 1.00
R0848:Pcm1 UTSW 8 41282683 missense probably damaging 1.00
R1027:Pcm1 UTSW 8 41293445 splice site probably benign
R1056:Pcm1 UTSW 8 41321900 missense probably damaging 1.00
R1534:Pcm1 UTSW 8 41287701 missense probably benign
R1566:Pcm1 UTSW 8 41290773 missense probably damaging 1.00
R1595:Pcm1 UTSW 8 41309635 missense probably damaging 1.00
R1719:Pcm1 UTSW 8 41313359 missense possibly damaging 0.62
R1816:Pcm1 UTSW 8 41309537 missense probably damaging 0.99
R2177:Pcm1 UTSW 8 41275965 missense probably benign
R2495:Pcm1 UTSW 8 41293579 missense probably benign
R3737:Pcm1 UTSW 8 41261043 nonsense probably null
R3747:Pcm1 UTSW 8 41332004 missense probably benign 0.44
R3763:Pcm1 UTSW 8 41280077 missense probably damaging 1.00
R3764:Pcm1 UTSW 8 41330882 missense probably damaging 1.00
R3798:Pcm1 UTSW 8 41258014 missense possibly damaging 0.66
R4760:Pcm1 UTSW 8 41287738 missense probably damaging 0.99
R4798:Pcm1 UTSW 8 41293678 missense probably damaging 1.00
R5062:Pcm1 UTSW 8 41259260 missense probably damaging 0.99
R5221:Pcm1 UTSW 8 41288156 critical splice donor site probably null
R5250:Pcm1 UTSW 8 41312205 missense probably damaging 0.99
R5466:Pcm1 UTSW 8 41272462 critical splice donor site probably null
R5470:Pcm1 UTSW 8 41287683 missense probably damaging 1.00
R5958:Pcm1 UTSW 8 41328979 missense probably damaging 1.00
R6043:Pcm1 UTSW 8 41328778 missense possibly damaging 0.54
R6179:Pcm1 UTSW 8 41283632 missense probably damaging 0.99
R6186:Pcm1 UTSW 8 41293793 missense probably benign 0.23
R6227:Pcm1 UTSW 8 41330825 missense probably damaging 0.99
R6368:Pcm1 UTSW 8 41293544 missense probably benign 0.09
R6438:Pcm1 UTSW 8 41325381 missense possibly damaging 0.94
R6459:Pcm1 UTSW 8 41261036 missense probably damaging 1.00
R7399:Pcm1 UTSW 8 41293510 missense probably benign 0.11
R7401:Pcm1 UTSW 8 41309531 missense probably damaging 1.00
X0025:Pcm1 UTSW 8 41330642 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGCAGTAGACAGTAGCCATTCC -3'
(R):5'- AGAAGGCTCTTGTTTCAATAGCTG -3'

Sequencing Primer
(F):5'- CAGTAGCCATTCCTAAGATTGAGTGG -3'
(R):5'- GCTGAAATATTTGTAACAACTACCTG -3'
Posted On2015-04-29