Incidental Mutation 'R3968:Narf'
ID312450
Institutional Source Beutler Lab
Gene Symbol Narf
Ensembl Gene ENSMUSG00000000056
Gene Namenuclear prelamin A recognition factor
Synonyms4430402O11Rik
MMRRC Submission 040936-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.129) question?
Stock #R3968 (G1)
Quality Score164
Status Validated
Chromosome11
Chromosomal Location121237253-121255856 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 121238421 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 10 (E10D)
Ref Sequence ENSEMBL: ENSMUSP00000099304 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103015]
Predicted Effect possibly damaging
Transcript: ENSMUST00000103015
AA Change: E10D

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000099304
Gene: ENSMUSG00000000056
AA Change: E10D

DomainStartEndE-ValueType
Pfam:Fe_hyd_lg_C 98 391 1e-75 PFAM
Fe_hyd_SSU 396 452 5.66e-19 SMART
Meta Mutation Damage Score 0.324 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.1%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Several proteins have been found to be prenylated and methylated at their carboxyl-terminal ends. Prenylation was initially believed to be important only for membrane attachment. However, another role for prenylation appears to be its importance in protein-protein interactions. The only nuclear proteins known to be prenylated in mammalian cells are prelamin A- and B-type lamins. Prelamin A is farnesylated and carboxymethylated on the cysteine residue of a carboxyl-terminal CaaX motif. This post-translationally modified cysteine residue is removed from prelamin A when it is endoproteolytically processed into mature lamin A. The protein encoded by this gene binds to the prenylated prelamin A carboxyl-terminal tail domain. It may be a component of a prelamin A endoprotease complex. The encoded protein is located in the nucleus, where it partially colocalizes with the nuclear lamina. It shares limited sequence similarity with iron-only bacterial hydrogenases. Alternatively spliced transcript variants encoding different isoforms have been identified for this gene, including one with a novel exon that is generated by RNA editing. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef12 C A 9: 43,005,551 R432L probably damaging Het
Camk4 T A 18: 33,179,581 I258N possibly damaging Het
Cdhr2 A T 13: 54,726,458 N781I probably damaging Het
Cela1 C T 15: 100,684,653 G93S probably damaging Het
Commd9 C A 2: 101,897,141 N93K probably benign Het
Cysltr2 A G 14: 73,030,174 I32T probably damaging Het
E2f1 C G 2: 154,564,022 G144R probably damaging Het
Fcho2 A T 13: 98,735,056 S551T probably benign Het
Fzd8 T C 18: 9,214,070 V384A probably damaging Het
Gm14401 T C 2: 177,086,996 Y292H possibly damaging Het
H2-M2 C T 17: 37,481,306 G318S possibly damaging Het
Il21r G T 7: 125,628,043 probably null Het
Itgam T C 7: 128,113,033 Y697H probably damaging Het
Itpkb A T 1: 180,327,798 probably benign Het
Lama3 A T 18: 12,580,341 K3230M probably damaging Het
Ly75 T C 2: 60,327,873 I1023V possibly damaging Het
Net1 A G 13: 3,907,795 probably null Het
Nlrx1 A T 9: 44,255,425 probably benign Het
Oard1 T C 17: 48,415,254 Y93H probably damaging Het
Olfr722 A T 14: 49,895,526 I92N probably damaging Het
Olfr921 A G 9: 38,775,368 T38A probably benign Het
Pcm1 T C 8: 41,325,830 L1825P probably damaging Het
Pecr G A 1: 72,276,309 T94I probably damaging Het
Piezo2 A T 18: 63,011,696 V2776E probably damaging Het
Pik3r2 G A 8: 70,770,421 R452C probably benign Het
Ppfia2 T A 10: 106,906,521 D1058E probably damaging Het
Ppl T C 16: 5,100,332 probably null Het
Rab39 G A 9: 53,686,632 A111V possibly damaging Het
Sema3g T C 14: 31,226,521 probably null Het
Slc19a1 T C 10: 77,041,846 Y72H probably damaging Het
Sntb2 T A 8: 106,997,140 Y340* probably null Het
Srrm4 A G 5: 116,444,744 probably benign Het
Ssb C T 2: 69,867,449 probably benign Het
Sval2 T A 6: 41,861,927 V14E probably damaging Het
Tmc2 T G 2: 130,202,071 V75G probably benign Het
Tnnc2 T C 2: 164,777,537 E129G possibly damaging Het
Vmn2r94 C A 17: 18,258,385 Q33H possibly damaging Het
Yap1 C T 9: 7,973,876 R188Q probably damaging Het
Other mutations in Narf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Narf APN 11 121238518 critical splice donor site probably null
R0128:Narf UTSW 11 121250836 missense probably damaging 1.00
R0542:Narf UTSW 11 121252864 missense probably damaging 1.00
R1326:Narf UTSW 11 121242553 missense probably damaging 1.00
R2035:Narf UTSW 11 121238500 missense probably benign 0.00
R2049:Narf UTSW 11 121250369 nonsense probably null
R2078:Narf UTSW 11 121245394 missense probably benign 0.03
R3711:Narf UTSW 11 121246938 nonsense probably null
R3967:Narf UTSW 11 121238421 missense possibly damaging 0.92
R3970:Narf UTSW 11 121238421 missense possibly damaging 0.92
R4128:Narf UTSW 11 121250435 splice site probably null
R4913:Narf UTSW 11 121244643 missense probably damaging 1.00
R4928:Narf UTSW 11 121244939 missense possibly damaging 0.87
R4946:Narf UTSW 11 121250353 missense possibly damaging 0.71
R5404:Narf UTSW 11 121242626 missense probably benign 0.00
R5799:Narf UTSW 11 121244654 missense probably damaging 1.00
R6753:Narf UTSW 11 121242626 missense probably benign 0.00
R6912:Narf UTSW 11 121238461 missense probably benign 0.00
R7311:Narf UTSW 11 121249150 missense probably benign 0.31
X0011:Narf UTSW 11 121250872 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGACTGCTCAGGATATGTTTTG -3'
(R):5'- CACGTTAGGCTGACACAAAC -3'

Sequencing Primer
(F):5'- CCAATGATCCCAGTGCTTGAGAG -3'
(R):5'- GTTAGGCTGACACAAACCCGATC -3'
Posted On2015-04-29