Incidental Mutation 'R3968:Net1'
ID312451
Institutional Source Beutler Lab
Gene Symbol Net1
Ensembl Gene ENSMUSG00000021215
Gene Nameneuroepithelial cell transforming gene 1
SynonymsmNET1, 0610025H04Rik, 9530071N24Rik, Net1 homolog
MMRRC Submission 040936-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.208) question?
Stock #R3968 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location3882018-3918220 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 3907795 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000089464 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091853] [ENSMUST00000091853]
Predicted Effect probably null
Transcript: ENSMUST00000091853
SMART Domains Protein: ENSMUSP00000089464
Gene: ENSMUSG00000021215

DomainStartEndE-ValueType
low complexity region 11 19 N/A INTRINSIC
low complexity region 73 84 N/A INTRINSIC
RhoGEF 178 355 2.84e-54 SMART
PH 387 503 5.79e-10 SMART
Predicted Effect probably null
Transcript: ENSMUST00000091853
SMART Domains Protein: ENSMUSP00000089464
Gene: ENSMUSG00000021215

DomainStartEndE-ValueType
low complexity region 11 19 N/A INTRINSIC
low complexity region 73 84 N/A INTRINSIC
RhoGEF 178 355 2.84e-54 SMART
PH 387 503 5.79e-10 SMART
Meta Mutation Damage Score 0.466 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.1%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is part of the family of Rho guanine nucleotide exchange factors. Members of this family activate Rho proteins by catalyzing the exchange of GDP for GTP. The protein encoded by this gene interacts with RhoA within the cell nucleus and may play a role in repairing DNA damage after ionizing radiation. Pseudogenes of this gene are located on the long arms of chromosomes 1, 7 and 18. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit delayed mammary gland development during puberty associated with slower ductal extension, reduced ductal branching and epithelial cell proliferation, disorganized myoepithelial and ductal epithelial cells, and increased collagen deposition. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef12 C A 9: 43,005,551 R432L probably damaging Het
Camk4 T A 18: 33,179,581 I258N possibly damaging Het
Cdhr2 A T 13: 54,726,458 N781I probably damaging Het
Cela1 C T 15: 100,684,653 G93S probably damaging Het
Commd9 C A 2: 101,897,141 N93K probably benign Het
Cysltr2 A G 14: 73,030,174 I32T probably damaging Het
E2f1 C G 2: 154,564,022 G144R probably damaging Het
Fcho2 A T 13: 98,735,056 S551T probably benign Het
Fzd8 T C 18: 9,214,070 V384A probably damaging Het
Gm14401 T C 2: 177,086,996 Y292H possibly damaging Het
H2-M2 C T 17: 37,481,306 G318S possibly damaging Het
Il21r G T 7: 125,628,043 probably null Het
Itgam T C 7: 128,113,033 Y697H probably damaging Het
Itpkb A T 1: 180,327,798 probably benign Het
Lama3 A T 18: 12,580,341 K3230M probably damaging Het
Ly75 T C 2: 60,327,873 I1023V possibly damaging Het
Narf A T 11: 121,238,421 E10D possibly damaging Het
Nlrx1 A T 9: 44,255,425 probably benign Het
Oard1 T C 17: 48,415,254 Y93H probably damaging Het
Olfr722 A T 14: 49,895,526 I92N probably damaging Het
Olfr921 A G 9: 38,775,368 T38A probably benign Het
Pcm1 T C 8: 41,325,830 L1825P probably damaging Het
Pecr G A 1: 72,276,309 T94I probably damaging Het
Piezo2 A T 18: 63,011,696 V2776E probably damaging Het
Pik3r2 G A 8: 70,770,421 R452C probably benign Het
Ppfia2 T A 10: 106,906,521 D1058E probably damaging Het
Ppl T C 16: 5,100,332 probably null Het
Rab39 G A 9: 53,686,632 A111V possibly damaging Het
Sema3g T C 14: 31,226,521 probably null Het
Slc19a1 T C 10: 77,041,846 Y72H probably damaging Het
Sntb2 T A 8: 106,997,140 Y340* probably null Het
Srrm4 A G 5: 116,444,744 probably benign Het
Ssb C T 2: 69,867,449 probably benign Het
Sval2 T A 6: 41,861,927 V14E probably damaging Het
Tmc2 T G 2: 130,202,071 V75G probably benign Het
Tnnc2 T C 2: 164,777,537 E129G possibly damaging Het
Vmn2r94 C A 17: 18,258,385 Q33H possibly damaging Het
Yap1 C T 9: 7,973,876 R188Q probably damaging Het
Other mutations in Net1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00886:Net1 APN 13 3893391 utr 5 prime probably benign
IGL02271:Net1 APN 13 3887663 missense probably damaging 1.00
IGL02698:Net1 APN 13 3887569 critical splice donor site probably null
R0580:Net1 UTSW 13 3886612 missense probably damaging 1.00
R1028:Net1 UTSW 13 3884375 missense probably damaging 1.00
R1070:Net1 UTSW 13 3912930 missense probably benign 0.31
R1775:Net1 UTSW 13 3887642 missense probably damaging 1.00
R1834:Net1 UTSW 13 3912941 unclassified probably benign
R4056:Net1 UTSW 13 3884949 missense probably damaging 1.00
R4884:Net1 UTSW 13 3884252 nonsense probably null
R4937:Net1 UTSW 13 3884905 missense probably damaging 1.00
R5068:Net1 UTSW 13 3886740 missense probably benign 0.30
R5123:Net1 UTSW 13 3886623 missense probably damaging 0.97
R5389:Net1 UTSW 13 3886170 missense probably damaging 1.00
R5390:Net1 UTSW 13 3893379 missense probably benign 0.18
R5509:Net1 UTSW 13 3884320 missense probably benign 0.00
R6548:Net1 UTSW 13 3886074 intron probably null
R7056:Net1 UTSW 13 3884845 missense probably benign 0.00
R7138:Net1 UTSW 13 3888510 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACCAAGGCAATCTGTGAGG -3'
(R):5'- GTCCAGAGACAATTTGGAATTTCCC -3'

Sequencing Primer
(F):5'- CAAACTGTTTATCAACTGGGGGCC -3'
(R):5'- CATATGCACCTGCGTGTGTACAG -3'
Posted On2015-04-29