Incidental Mutation 'R3968:Sema3g'
ID312454
Institutional Source Beutler Lab
Gene Symbol Sema3g
Ensembl Gene ENSMUSG00000021904
Gene Namesema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3G
Synonyms
MMRRC Submission 040936-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3968 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location31217860-31230352 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 31226521 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000087643 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090180]
Predicted Effect probably null
Transcript: ENSMUST00000090180
SMART Domains Protein: ENSMUSP00000087643
Gene: ENSMUSG00000021904

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Sema 58 503 2.96e-184 SMART
PSI 521 574 3.2e-11 SMART
IG 588 674 6.41e-2 SMART
Meta Mutation Damage Score 0.636 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.1%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The transcription of this gene is activated by PPAR-gamma, and the resulting protein product plays a role in endothelial cell migration. Expression of this gene also inhibits tumor cell migration and invasion. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased lymphatic branching complexity with decreased lymphatic width. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef12 C A 9: 43,005,551 R432L probably damaging Het
Camk4 T A 18: 33,179,581 I258N possibly damaging Het
Cdhr2 A T 13: 54,726,458 N781I probably damaging Het
Cela1 C T 15: 100,684,653 G93S probably damaging Het
Commd9 C A 2: 101,897,141 N93K probably benign Het
Cysltr2 A G 14: 73,030,174 I32T probably damaging Het
E2f1 C G 2: 154,564,022 G144R probably damaging Het
Fcho2 A T 13: 98,735,056 S551T probably benign Het
Fzd8 T C 18: 9,214,070 V384A probably damaging Het
Gm14401 T C 2: 177,086,996 Y292H possibly damaging Het
H2-M2 C T 17: 37,481,306 G318S possibly damaging Het
Il21r G T 7: 125,628,043 probably null Het
Itgam T C 7: 128,113,033 Y697H probably damaging Het
Itpkb A T 1: 180,327,798 probably benign Het
Lama3 A T 18: 12,580,341 K3230M probably damaging Het
Ly75 T C 2: 60,327,873 I1023V possibly damaging Het
Narf A T 11: 121,238,421 E10D possibly damaging Het
Net1 A G 13: 3,907,795 probably null Het
Nlrx1 A T 9: 44,255,425 probably benign Het
Oard1 T C 17: 48,415,254 Y93H probably damaging Het
Olfr722 A T 14: 49,895,526 I92N probably damaging Het
Olfr921 A G 9: 38,775,368 T38A probably benign Het
Pcm1 T C 8: 41,325,830 L1825P probably damaging Het
Pecr G A 1: 72,276,309 T94I probably damaging Het
Piezo2 A T 18: 63,011,696 V2776E probably damaging Het
Pik3r2 G A 8: 70,770,421 R452C probably benign Het
Ppfia2 T A 10: 106,906,521 D1058E probably damaging Het
Ppl T C 16: 5,100,332 probably null Het
Rab39 G A 9: 53,686,632 A111V possibly damaging Het
Slc19a1 T C 10: 77,041,846 Y72H probably damaging Het
Sntb2 T A 8: 106,997,140 Y340* probably null Het
Srrm4 A G 5: 116,444,744 probably benign Het
Ssb C T 2: 69,867,449 probably benign Het
Sval2 T A 6: 41,861,927 V14E probably damaging Het
Tmc2 T G 2: 130,202,071 V75G probably benign Het
Tnnc2 T C 2: 164,777,537 E129G possibly damaging Het
Vmn2r94 C A 17: 18,258,385 Q33H possibly damaging Het
Yap1 C T 9: 7,973,876 R188Q probably damaging Het
Other mutations in Sema3g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01626:Sema3g APN 14 31221727 missense probably damaging 1.00
IGL01650:Sema3g APN 14 31221787 missense probably benign 0.00
IGL01782:Sema3g APN 14 31227791 missense probably damaging 1.00
IGL01784:Sema3g APN 14 31222967 missense probably damaging 1.00
IGL01869:Sema3g APN 14 31223667 missense probably damaging 1.00
IGL01999:Sema3g APN 14 31217965 missense probably benign
IGL02095:Sema3g APN 14 31227824 missense probably benign 0.00
IGL02232:Sema3g APN 14 31221224 missense probably damaging 1.00
IGL02477:Sema3g APN 14 31227866 missense probably damaging 0.98
IGL02583:Sema3g APN 14 31221519 critical splice acceptor site probably null
R0791:Sema3g UTSW 14 31220904 splice site probably benign
R1225:Sema3g UTSW 14 31220679 missense probably damaging 1.00
R1471:Sema3g UTSW 14 31228045 missense probably damaging 1.00
R2303:Sema3g UTSW 14 31222615 missense probably damaging 1.00
R3970:Sema3g UTSW 14 31226521 critical splice donor site probably null
R4406:Sema3g UTSW 14 31228159 missense probably benign 0.01
R4773:Sema3g UTSW 14 31220709 missense probably benign 0.04
X0013:Sema3g UTSW 14 31222111 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TAGTTCCCTTGCTGACCTGG -3'
(R):5'- GCGTTAGCATAGGAACCTTCC -3'

Sequencing Primer
(F):5'- GGCCTGATCCTCTCTACAGAAG -3'
(R):5'- ATCCCCCTCACAGAGTAGGGAG -3'
Posted On2015-04-29