Incidental Mutation 'R3968:Cela1'
ID312457
Institutional Source Beutler Lab
Gene Symbol Cela1
Ensembl Gene ENSMUSG00000023031
Gene Namechymotrypsin-like elastase family, member 1
Synonyms1810062B19Rik, Ela1, Ela-1, 1810009A17Rik, PC-TsF
MMRRC Submission 040936-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.131) question?
Stock #R3968 (G1)
Quality Score184
Status Not validated
Chromosome15
Chromosomal Location100674421-100687921 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 100684653 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 93 (G93S)
Ref Sequence ENSEMBL: ENSMUSP00000023775 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023775] [ENSMUST00000230572] [ENSMUST00000230740]
Predicted Effect probably damaging
Transcript: ENSMUST00000023775
AA Change: G93S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023775
Gene: ENSMUSG00000023031
AA Change: G93S

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Tryp_SPc 26 259 1.24e-88 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229235
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229888
Predicted Effect unknown
Transcript: ENSMUST00000230312
AA Change: G30S
Predicted Effect probably benign
Transcript: ENSMUST00000230572
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230642
Predicted Effect probably benign
Transcript: ENSMUST00000230740
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.1%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Elastases form a subfamily of serine proteases that hydrolyze many proteins in addition to elastin. Humans have six elastase genes which encode the structurally similar proteins elastase 1, 2, 2A, 2B, 3A, and 3B. Unlike other elastases, pancreatic elastase 1 is not expressed in the pancreas. To date, elastase 1 expression has only been detected in skin keratinocytes. Clinical literature that describes human elastase 1 activity in the pancreas or fecal material is actually referring to chymotrypsin-like elastase family, member 3B. [provided by RefSeq, May 2009]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef12 C A 9: 43,005,551 R432L probably damaging Het
Camk4 T A 18: 33,179,581 I258N possibly damaging Het
Cdhr2 A T 13: 54,726,458 N781I probably damaging Het
Commd9 C A 2: 101,897,141 N93K probably benign Het
Cysltr2 A G 14: 73,030,174 I32T probably damaging Het
E2f1 C G 2: 154,564,022 G144R probably damaging Het
Fcho2 A T 13: 98,735,056 S551T probably benign Het
Fzd8 T C 18: 9,214,070 V384A probably damaging Het
Gm14401 T C 2: 177,086,996 Y292H possibly damaging Het
H2-M2 C T 17: 37,481,306 G318S possibly damaging Het
Il21r G T 7: 125,628,043 probably null Het
Itgam T C 7: 128,113,033 Y697H probably damaging Het
Itpkb A T 1: 180,327,798 probably benign Het
Lama3 A T 18: 12,580,341 K3230M probably damaging Het
Ly75 T C 2: 60,327,873 I1023V possibly damaging Het
Narf A T 11: 121,238,421 E10D possibly damaging Het
Net1 A G 13: 3,907,795 probably null Het
Nlrx1 A T 9: 44,255,425 probably benign Het
Oard1 T C 17: 48,415,254 Y93H probably damaging Het
Olfr722 A T 14: 49,895,526 I92N probably damaging Het
Olfr921 A G 9: 38,775,368 T38A probably benign Het
Pcm1 T C 8: 41,325,830 L1825P probably damaging Het
Pecr G A 1: 72,276,309 T94I probably damaging Het
Piezo2 A T 18: 63,011,696 V2776E probably damaging Het
Pik3r2 G A 8: 70,770,421 R452C probably benign Het
Ppfia2 T A 10: 106,906,521 D1058E probably damaging Het
Ppl T C 16: 5,100,332 probably null Het
Rab39 G A 9: 53,686,632 A111V possibly damaging Het
Sema3g T C 14: 31,226,521 probably null Het
Slc19a1 T C 10: 77,041,846 Y72H probably damaging Het
Sntb2 T A 8: 106,997,140 Y340* probably null Het
Srrm4 A G 5: 116,444,744 probably benign Het
Ssb C T 2: 69,867,449 probably benign Het
Sval2 T A 6: 41,861,927 V14E probably damaging Het
Tmc2 T G 2: 130,202,071 V75G probably benign Het
Tnnc2 T C 2: 164,777,537 E129G possibly damaging Het
Vmn2r94 C A 17: 18,258,385 Q33H possibly damaging Het
Yap1 C T 9: 7,973,876 R188Q probably damaging Het
Other mutations in Cela1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1845:Cela1 UTSW 15 100685167 missense probably benign 0.43
R2060:Cela1 UTSW 15 100675322 critical splice donor site probably null
R2358:Cela1 UTSW 15 100681228 missense probably benign
R4236:Cela1 UTSW 15 100682913 missense probably damaging 1.00
R5491:Cela1 UTSW 15 100682980 missense probably damaging 1.00
R6140:Cela1 UTSW 15 100681156 missense probably benign 0.01
R6378:Cela1 UTSW 15 100687190 missense probably benign 0.00
R7057:Cela1 UTSW 15 100682893 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- AGTTTCAGCCAATCCCTCTG -3'
(R):5'- GAATGAGAGCGCTTGTCCTG -3'

Sequencing Primer
(F):5'- AATCCCTCTGTCCGGTGGAG -3'
(R):5'- AGCGCTTGTCCTGCCTCAC -3'
Posted On2015-04-29