Incidental Mutation 'R3968:Ppl'
ID312458
Institutional Source Beutler Lab
Gene Symbol Ppl
Ensembl Gene ENSMUSG00000039457
Gene Nameperiplakin
Synonyms
MMRRC Submission 040936-MU
Accession Numbers

Genbank: NM_008909

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3968 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location5086291-5132421 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 5100332 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000039360 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035672]
Predicted Effect probably null
Transcript: ENSMUST00000035672
SMART Domains Protein: ENSMUSP00000039360
Gene: ENSMUSG00000039457

DomainStartEndE-ValueType
SPEC 123 211 1.58e0 SMART
SPEC 214 315 3.38e-2 SMART
SPEC 321 483 1.11e-2 SMART
SPEC 503 610 4.96e0 SMART
Blast:SPEC 613 717 5e-59 BLAST
low complexity region 718 729 N/A INTRINSIC
Blast:SPEC 732 859 2e-60 BLAST
low complexity region 893 908 N/A INTRINSIC
low complexity region 963 982 N/A INTRINSIC
internal_repeat_2 984 1004 3.46e-5 PROSPERO
internal_repeat_1 992 1008 8.09e-7 PROSPERO
low complexity region 1011 1020 N/A INTRINSIC
low complexity region 1027 1042 N/A INTRINSIC
internal_repeat_1 1112 1128 8.09e-7 PROSPERO
coiled coil region 1180 1279 N/A INTRINSIC
low complexity region 1346 1355 N/A INTRINSIC
low complexity region 1386 1433 N/A INTRINSIC
low complexity region 1455 1479 N/A INTRINSIC
Blast:SPEC 1529 1610 8e-30 BLAST
low complexity region 1612 1630 N/A INTRINSIC
PLEC 1649 1683 1.34e-5 SMART
PLEC 1698 1733 2.23e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230554
Meta Mutation Damage Score 0.6096 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.1%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of desmosomes and of the epidermal cornified envelope in keratinocytes. The N-terminal domain of this protein interacts with the plasma membrane and its C-terminus interacts with intermediate filaments. Through its rod domain, this protein forms complexes with envoplakin. This protein may serve as a link between the cornified envelope and desmosomes as well as intermediate filaments. AKT1/PKB, a protein kinase mediating a variety of cell growth and survival signaling processes, is reported to interact with this protein, suggesting a possible role for this protein as a localization signal in AKT1-mediated signaling. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are fertile and grossly normal with no apparent skin abnormalities. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef12 C A 9: 43,005,551 R432L probably damaging Het
Camk4 T A 18: 33,179,581 I258N possibly damaging Het
Cdhr2 A T 13: 54,726,458 N781I probably damaging Het
Cela1 C T 15: 100,684,653 G93S probably damaging Het
Commd9 C A 2: 101,897,141 N93K probably benign Het
Cysltr2 A G 14: 73,030,174 I32T probably damaging Het
E2f1 C G 2: 154,564,022 G144R probably damaging Het
Fcho2 A T 13: 98,735,056 S551T probably benign Het
Fzd8 T C 18: 9,214,070 V384A probably damaging Het
Gm14401 T C 2: 177,086,996 Y292H possibly damaging Het
H2-M2 C T 17: 37,481,306 G318S possibly damaging Het
Il21r G T 7: 125,628,043 probably null Het
Itgam T C 7: 128,113,033 Y697H probably damaging Het
Itpkb A T 1: 180,327,798 probably benign Het
Lama3 A T 18: 12,580,341 K3230M probably damaging Het
Ly75 T C 2: 60,327,873 I1023V possibly damaging Het
Narf A T 11: 121,238,421 E10D possibly damaging Het
Net1 A G 13: 3,907,795 probably null Het
Nlrx1 A T 9: 44,255,425 probably benign Het
Oard1 T C 17: 48,415,254 Y93H probably damaging Het
Olfr722 A T 14: 49,895,526 I92N probably damaging Het
Olfr921 A G 9: 38,775,368 T38A probably benign Het
Pcm1 T C 8: 41,325,830 L1825P probably damaging Het
Pecr G A 1: 72,276,309 T94I probably damaging Het
Piezo2 A T 18: 63,011,696 V2776E probably damaging Het
Pik3r2 G A 8: 70,770,421 R452C probably benign Het
Ppfia2 T A 10: 106,906,521 D1058E probably damaging Het
Rab39 G A 9: 53,686,632 A111V possibly damaging Het
Sema3g T C 14: 31,226,521 probably null Het
Slc19a1 T C 10: 77,041,846 Y72H probably damaging Het
Sntb2 T A 8: 106,997,140 Y340* probably null Het
Srrm4 A G 5: 116,444,744 probably benign Het
Ssb C T 2: 69,867,449 probably benign Het
Sval2 T A 6: 41,861,927 V14E probably damaging Het
Tmc2 T G 2: 130,202,071 V75G probably benign Het
Tnnc2 T C 2: 164,777,537 E129G possibly damaging Het
Vmn2r94 C A 17: 18,258,385 Q33H possibly damaging Het
Yap1 C T 9: 7,973,876 R188Q probably damaging Het
Other mutations in Ppl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Ppl APN 16 5089545 missense probably benign 0.41
IGL00484:Ppl APN 16 5087952 missense probably benign 0.13
IGL00654:Ppl APN 16 5087308 missense possibly damaging 0.94
IGL00832:Ppl APN 16 5088975 missense probably damaging 1.00
IGL01104:Ppl APN 16 5094491 missense probably benign 0.01
IGL01327:Ppl APN 16 5087644 missense probably benign 0.19
IGL01644:Ppl APN 16 5091855 missense probably damaging 1.00
IGL01824:Ppl APN 16 5087889 missense probably damaging 1.00
IGL02071:Ppl APN 16 5113072 missense probably benign 0.04
IGL02085:Ppl APN 16 5089816 missense probably benign 0.09
IGL02282:Ppl APN 16 5101458 missense probably damaging 1.00
IGL02635:Ppl APN 16 5089767 missense probably benign 0.01
IGL02649:Ppl APN 16 5087463 missense probably damaging 1.00
IGL02888:Ppl APN 16 5100407 missense possibly damaging 0.89
IGL03305:Ppl APN 16 5093233 missense possibly damaging 0.62
G4846:Ppl UTSW 16 5087206 missense probably damaging 1.00
IGL03097:Ppl UTSW 16 5096726 missense probably damaging 0.98
R0759:Ppl UTSW 16 5089777 missense probably benign 0.00
R0786:Ppl UTSW 16 5089054 missense probably damaging 1.00
R1024:Ppl UTSW 16 5100000 missense probably damaging 1.00
R1498:Ppl UTSW 16 5104765 missense probably benign 0.05
R1544:Ppl UTSW 16 5102597 nonsense probably null
R1597:Ppl UTSW 16 5107574 missense probably benign 0.20
R1863:Ppl UTSW 16 5087980 missense possibly damaging 0.69
R1921:Ppl UTSW 16 5106124 missense possibly damaging 0.80
R2230:Ppl UTSW 16 5088981 missense possibly damaging 0.51
R2275:Ppl UTSW 16 5094552 missense probably benign 0.00
R2355:Ppl UTSW 16 5094497 missense probably benign 0.00
R3410:Ppl UTSW 16 5107517 missense possibly damaging 0.81
R3737:Ppl UTSW 16 5106857 missense probably benign
R3797:Ppl UTSW 16 5104550 splice site probably benign
R3970:Ppl UTSW 16 5100332 splice site probably null
R4034:Ppl UTSW 16 5106857 missense probably benign
R4583:Ppl UTSW 16 5104536 missense probably benign 0.02
R4639:Ppl UTSW 16 5089446 missense probably damaging 1.00
R4762:Ppl UTSW 16 5088982 missense probably benign 0.00
R4828:Ppl UTSW 16 5104926 missense probably damaging 1.00
R4869:Ppl UTSW 16 5104889 missense probably damaging 0.99
R4925:Ppl UTSW 16 5104982 missense probably damaging 1.00
R4983:Ppl UTSW 16 5088718 missense possibly damaging 0.75
R4984:Ppl UTSW 16 5087641 missense probably benign
R4997:Ppl UTSW 16 5089371 missense probably damaging 1.00
R5072:Ppl UTSW 16 5088878 missense probably benign 0.01
R5073:Ppl UTSW 16 5088878 missense probably benign 0.01
R5074:Ppl UTSW 16 5088878 missense probably benign 0.01
R5286:Ppl UTSW 16 5089123 nonsense probably null
R5398:Ppl UTSW 16 5104922 missense probably benign 0.00
R5448:Ppl UTSW 16 5107566 missense probably benign
R5664:Ppl UTSW 16 5106055 missense probably benign 0.00
R5873:Ppl UTSW 16 5106049 critical splice donor site probably null
R5918:Ppl UTSW 16 5104901 missense probably benign 0.00
R5951:Ppl UTSW 16 5088628 missense probably benign 0.25
R6038:Ppl UTSW 16 5102581 missense possibly damaging 0.94
R6038:Ppl UTSW 16 5102581 missense possibly damaging 0.94
R6088:Ppl UTSW 16 5104988 missense possibly damaging 0.73
R6149:Ppl UTSW 16 5107596 nonsense probably null
R6358:Ppl UTSW 16 5087929 nonsense probably null
R6379:Ppl UTSW 16 5097691 missense probably benign 0.02
R6468:Ppl UTSW 16 5092441 missense probably damaging 1.00
R6514:Ppl UTSW 16 5087317 missense probably damaging 1.00
R6528:Ppl UTSW 16 5087616 missense probably benign 0.00
R6703:Ppl UTSW 16 5089464 missense probably damaging 0.99
R6721:Ppl UTSW 16 5107469 missense probably damaging 0.97
R6811:Ppl UTSW 16 5089144 missense probably damaging 0.99
R6934:Ppl UTSW 16 5094509 missense probably benign 0.00
R7034:Ppl UTSW 16 5087502 missense probably benign 0.29
R7076:Ppl UTSW 16 5100119 missense probably damaging 1.00
R7300:Ppl UTSW 16 5102371 missense possibly damaging 0.87
R7349:Ppl UTSW 16 5104729 missense probably damaging 0.99
R7359:Ppl UTSW 16 5089341 missense possibly damaging 0.78
R7378:Ppl UTSW 16 5112996 missense possibly damaging 0.91
R7383:Ppl UTSW 16 5097971 missense probably damaging 1.00
R7445:Ppl UTSW 16 5089068 missense probably damaging 1.00
X0054:Ppl UTSW 16 5104902 missense probably benign 0.00
Z1088:Ppl UTSW 16 5089507 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- ATCTGTCGTAGGGAGGACAAATC -3'
(R):5'- ACCCTCCAAGGAGCTACTTG -3'

Sequencing Primer
(F):5'- GGACAAATCAGGGATGACAGTG -3'
(R):5'- AGCTACTTGGCTCCCATGG -3'
Posted On2015-04-29