Incidental Mutation 'R3968:Fzd8'
ID312462
Institutional Source Beutler Lab
Gene Symbol Fzd8
Ensembl Gene ENSMUSG00000036904
Gene Namefrizzled class receptor 8
SynonymsmFZ8, Fz8
MMRRC Submission 040936-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3968 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location9212856-9216201 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 9214070 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 384 (V384A)
Ref Sequence ENSEMBL: ENSMUSP00000039660 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041080]
PDB Structure
CRYSTAL STRUCTURE OF THE CYSTEINE-RICH DOMAIN OF MOUSE FRIZZLED 8 (MFZ8) [X-RAY DIFFRACTION]
Crystal structure of XWnt8 in complex with the cysteine-rich domain of Frizzled 8 [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000041080
AA Change: V384A

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000039660
Gene: ENSMUSG00000036904
AA Change: V384A

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
FRI 34 153 9.06e-73 SMART
low complexity region 161 228 N/A INTRINSIC
Frizzled 264 621 1.47e-219 SMART
low complexity region 624 655 N/A INTRINSIC
Meta Mutation Damage Score 0.156 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.1%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This intronless gene is a member of the frizzled gene family. Members of this family encode seven-transmembrane domain proteins that are receptors for the Wingless type MMTV integration site family of signaling proteins. Most frizzled receptors are coupled to the beta-catenin canonical signaling pathway. This gene is highly expressed in two human cancer cell lines, indicating that it may play a role in several types of cancer. The crystal structure of the extracellular cysteine-rich domain of a similar mouse protein has been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene does not appear to result in a phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef12 C A 9: 43,005,551 R432L probably damaging Het
Camk4 T A 18: 33,179,581 I258N possibly damaging Het
Cdhr2 A T 13: 54,726,458 N781I probably damaging Het
Cela1 C T 15: 100,684,653 G93S probably damaging Het
Commd9 C A 2: 101,897,141 N93K probably benign Het
Cysltr2 A G 14: 73,030,174 I32T probably damaging Het
E2f1 C G 2: 154,564,022 G144R probably damaging Het
Fcho2 A T 13: 98,735,056 S551T probably benign Het
Gm14401 T C 2: 177,086,996 Y292H possibly damaging Het
H2-M2 C T 17: 37,481,306 G318S possibly damaging Het
Il21r G T 7: 125,628,043 probably null Het
Itgam T C 7: 128,113,033 Y697H probably damaging Het
Itpkb A T 1: 180,327,798 probably benign Het
Lama3 A T 18: 12,580,341 K3230M probably damaging Het
Ly75 T C 2: 60,327,873 I1023V possibly damaging Het
Narf A T 11: 121,238,421 E10D possibly damaging Het
Net1 A G 13: 3,907,795 probably null Het
Nlrx1 A T 9: 44,255,425 probably benign Het
Oard1 T C 17: 48,415,254 Y93H probably damaging Het
Olfr722 A T 14: 49,895,526 I92N probably damaging Het
Olfr921 A G 9: 38,775,368 T38A probably benign Het
Pcm1 T C 8: 41,325,830 L1825P probably damaging Het
Pecr G A 1: 72,276,309 T94I probably damaging Het
Piezo2 A T 18: 63,011,696 V2776E probably damaging Het
Pik3r2 G A 8: 70,770,421 R452C probably benign Het
Ppfia2 T A 10: 106,906,521 D1058E probably damaging Het
Ppl T C 16: 5,100,332 probably null Het
Rab39 G A 9: 53,686,632 A111V possibly damaging Het
Sema3g T C 14: 31,226,521 probably null Het
Slc19a1 T C 10: 77,041,846 Y72H probably damaging Het
Sntb2 T A 8: 106,997,140 Y340* probably null Het
Srrm4 A G 5: 116,444,744 probably benign Het
Ssb C T 2: 69,867,449 probably benign Het
Sval2 T A 6: 41,861,927 V14E probably damaging Het
Tmc2 T G 2: 130,202,071 V75G probably benign Het
Tnnc2 T C 2: 164,777,537 E129G possibly damaging Het
Vmn2r94 C A 17: 18,258,385 Q33H possibly damaging Het
Yap1 C T 9: 7,973,876 R188Q probably damaging Het
Other mutations in Fzd8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00571:Fzd8 APN 18 9213068 missense unknown
IGL01511:Fzd8 APN 18 9213293 missense unknown
IGL03129:Fzd8 APN 18 9214270 missense probably damaging 1.00
Stilt UTSW 18 9213880 missense probably damaging 1.00
R0058:Fzd8 UTSW 18 9213985 missense possibly damaging 0.92
R0715:Fzd8 UTSW 18 9212947 missense unknown
R0966:Fzd8 UTSW 18 9214745 missense probably damaging 0.99
R1717:Fzd8 UTSW 18 9214364 missense probably damaging 1.00
R1751:Fzd8 UTSW 18 9213643 missense probably damaging 0.98
R1761:Fzd8 UTSW 18 9213643 missense probably damaging 0.98
R1905:Fzd8 UTSW 18 9213803 missense probably damaging 1.00
R1956:Fzd8 UTSW 18 9214502 missense probably damaging 1.00
R2892:Fzd8 UTSW 18 9214514 missense probably damaging 1.00
R3897:Fzd8 UTSW 18 9214939 missense possibly damaging 0.89
R4934:Fzd8 UTSW 18 9214492 frame shift probably null
R5366:Fzd8 UTSW 18 9213880 missense probably damaging 1.00
R5624:Fzd8 UTSW 18 9213268 missense unknown
R6261:Fzd8 UTSW 18 9214598 missense possibly damaging 0.61
R6757:Fzd8 UTSW 18 9213238 missense possibly damaging 0.78
R6758:Fzd8 UTSW 18 9213238 missense possibly damaging 0.78
R6899:Fzd8 UTSW 18 9214729 missense probably damaging 0.98
R7242:Fzd8 UTSW 18 9214171 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAACGGCCCATCATATTCCTC -3'
(R):5'- AAGCCGCGTAGGTTGTCAAG -3'

Sequencing Primer
(F):5'- ACCTCTTCGTGTCTGTCGGG -3'
(R):5'- TTGCCCACGTAGCAGATG -3'
Posted On2015-04-29