Incidental Mutation 'R3974:Adam23'
ID312501
Institutional Source Beutler Lab
Gene Symbol Adam23
Ensembl Gene ENSMUSG00000025964
Gene Namea disintegrin and metallopeptidase domain 23
SynonymsMDC3
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3974 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location63445891-63596276 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 63547729 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 416 (Y416*)
Ref Sequence ENSEMBL: ENSMUSP00000109742 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087374] [ENSMUST00000114103] [ENSMUST00000114107]
Predicted Effect probably null
Transcript: ENSMUST00000087374
AA Change: Y416*
SMART Domains Protein: ENSMUSP00000084633
Gene: ENSMUSG00000025964
AA Change: Y416*

DomainStartEndE-ValueType
signal peptide 1 55 N/A INTRINSIC
Pfam:Pep_M12B_propep 89 247 1.8e-30 PFAM
Pfam:Reprolysin_5 295 470 4.3e-9 PFAM
Pfam:Reprolysin 296 493 1.1e-58 PFAM
Pfam:Reprolysin_3 320 426 1.4e-8 PFAM
DISIN 508 583 2.81e-28 SMART
ACR 584 725 1.11e-60 SMART
EGF 732 766 1.87e1 SMART
transmembrane domain 791 813 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000097717
SMART Domains Protein: ENSMUSP00000095324
Gene: ENSMUSG00000025964

DomainStartEndE-ValueType
Pfam:Pep_M12B_propep 2 63 6.3e-16 PFAM
Pfam:Reprolysin_5 111 286 2.7e-7 PFAM
Pfam:Reprolysin 112 309 5.7e-57 PFAM
Pfam:Reprolysin_3 136 240 8.7e-7 PFAM
DISIN 324 399 1.4e-30 SMART
ACR 400 541 3.6e-63 SMART
EGF 548 582 9e-2 SMART
transmembrane domain 607 629 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000114101
SMART Domains Protein: ENSMUSP00000109736
Gene: ENSMUSG00000025964

DomainStartEndE-ValueType
signal peptide 1 55 N/A INTRINSIC
Pfam:Pep_M12B_propep 87 247 1.3e-30 PFAM
Pfam:Reprolysin_5 295 470 3.3e-9 PFAM
Pfam:Reprolysin 296 493 8.1e-59 PFAM
Pfam:Reprolysin_3 320 426 1.1e-8 PFAM
DISIN 508 583 2.81e-28 SMART
ACR 584 686 4.34e-31 SMART
Predicted Effect probably null
Transcript: ENSMUST00000114103
AA Change: Y416*
SMART Domains Protein: ENSMUSP00000139862
Gene: ENSMUSG00000025964
AA Change: Y416*

DomainStartEndE-ValueType
signal peptide 1 55 N/A INTRINSIC
Pfam:Pep_M12B_propep 89 247 1.8e-30 PFAM
Pfam:Reprolysin_5 295 470 4.3e-9 PFAM
Pfam:Reprolysin 296 493 1.1e-58 PFAM
Pfam:Reprolysin_3 320 426 1.4e-8 PFAM
DISIN 508 583 2.81e-28 SMART
ACR 584 725 1.11e-60 SMART
EGF 732 766 1.87e1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000114107
AA Change: Y416*
SMART Domains Protein: ENSMUSP00000109742
Gene: ENSMUSG00000025964
AA Change: Y416*

DomainStartEndE-ValueType
signal peptide 1 55 N/A INTRINSIC
Pfam:Pep_M12B_propep 89 247 1.8e-30 PFAM
Pfam:Reprolysin_5 295 470 4.3e-9 PFAM
Pfam:Reprolysin 296 493 1.1e-58 PFAM
Pfam:Reprolysin_3 320 426 1.4e-8 PFAM
DISIN 508 583 2.81e-28 SMART
ACR 584 725 1.11e-60 SMART
EGF 732 766 1.87e1 SMART
transmembrane domain 791 813 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182642
SMART Domains Protein: ENSMUSP00000138362
Gene: ENSMUSG00000025964

DomainStartEndE-ValueType
signal peptide 1 55 N/A INTRINSIC
Pfam:Pep_M12B_propep 89 247 2.2e-30 PFAM
Pfam:Reprolysin_5 295 470 4.6e-9 PFAM
Pfam:Reprolysin 296 493 1.4e-58 PFAM
Pfam:Reprolysin_3 320 426 1.6e-8 PFAM
DISIN 508 583 2.81e-28 SMART
ACR 584 725 1.11e-60 SMART
EGF 732 766 1.87e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190658
Meta Mutation Damage Score 0.614 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the disintegrin family of membrane-anchored proteins that play a role in diverse biological processes such as brain development, fertilization, tumor development and inflammation. The encoded protein undergoes proteolytic processing to generate a mature polypeptide comprised of an inactive metalloprotease and disintegrin domains. Transgenic disruption of this gene in mice results in postnatal neurological defects including tremor and ataxia resulting in death by 2 weeks of age. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for an insertional mutation that inactivates the gene are smaller than normal littermates, show delayed lung development, are lethal by postnatal day 14, and display severe tremor and ataxia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510039O18Rik T C 4: 147,945,031 I486T probably damaging Het
Abca8a A T 11: 110,083,502 M202K probably damaging Het
Abhd4 T A 14: 54,262,960 I117N probably damaging Het
Cenpe A G 3: 135,235,225 probably null Het
Cenph A G 13: 100,763,567 V151A probably damaging Het
Cfap54 A G 10: 92,839,471 S2863P possibly damaging Het
Clca1 A T 3: 145,032,639 V36D probably damaging Het
Cnbd1 G A 4: 18,887,693 R274C probably benign Het
Crot T C 5: 8,977,541 T264A probably benign Het
Dll4 A G 2: 119,334,092 D664G probably damaging Het
Ehbp1 C T 11: 22,137,867 A406T probably benign Het
Far2 T A 6: 148,150,754 I177N probably damaging Het
Flt4 T G 11: 49,636,740 V910G probably damaging Het
Fmod A G 1: 134,040,758 R179G probably benign Het
Gdf2 T A 14: 33,944,834 V171D probably damaging Het
Gm884 A T 11: 103,619,101 probably benign Het
Gpx6 C A 13: 21,317,658 S150Y probably damaging Het
Grik2 A T 10: 49,422,654 Y37N probably damaging Het
Grn T C 11: 102,436,339 V559A probably damaging Het
Muc2 T A 7: 141,746,804 probably benign Het
Myo5b T C 18: 74,634,481 Y287H probably damaging Het
Nbeal2 T C 9: 110,633,846 T1350A probably damaging Het
Nfkbiz T C 16: 55,818,436 I220M probably benign Het
Nt5dc2 T C 14: 31,138,875 S439P probably damaging Het
Olfr1049 A T 2: 86,255,591 I34N possibly damaging Het
Olfr598 T G 7: 103,329,078 D197E probably damaging Het
Omg T A 11: 79,502,398 E211D probably benign Het
Pcdhb4 A G 18: 37,308,848 T404A possibly damaging Het
Plcl1 T A 1: 55,698,215 M905K probably benign Het
Plod2 G T 9: 92,598,619 G422* probably null Het
Ppp1r12a T C 10: 108,253,480 V660A probably benign Het
Prdm6 T C 18: 53,540,206 I186T possibly damaging Het
Ptprq T G 10: 107,712,062 K158N possibly damaging Het
Rimbp2 A G 5: 128,797,798 V243A probably damaging Het
Rp1l1 T A 14: 64,030,309 Y1115N probably damaging Het
Rtn4 C T 11: 29,707,505 T553I probably damaging Het
Scrn3 T C 2: 73,335,777 S385P possibly damaging Het
Serpina1f C A 12: 103,693,571 G151* probably null Het
Sis T C 3: 72,943,635 T577A probably damaging Het
Slco1a1 A T 6: 141,909,093 S611T probably benign Het
Smad4 G T 18: 73,677,736 T59K possibly damaging Het
Syne1 T C 10: 5,043,630 D8370G probably benign Het
Tigd4 G A 3: 84,595,278 A501T possibly damaging Het
Tjp1 A T 7: 65,297,639 C1724* probably null Het
Tmem107 G T 11: 69,071,475 probably null Het
Tsc22d1 T C 14: 76,418,609 S761P probably damaging Het
Tyw5 A T 1: 57,391,528 D165E probably damaging Het
U2af2 T A 7: 5,069,439 probably null Het
Ube3b T A 5: 114,412,430 D839E probably benign Het
Ush2a A G 1: 188,381,501 D639G probably benign Het
Veph1 A T 3: 66,158,227 M473K probably benign Het
Vmn2r72 A T 7: 85,749,809 N445K probably damaging Het
Vps37d T C 5: 135,076,539 M77V probably null Het
Other mutations in Adam23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00518:Adam23 APN 1 63570954 missense probably damaging 0.99
IGL00957:Adam23 APN 1 63534311 missense probably benign 0.27
IGL01338:Adam23 APN 1 63551855 missense possibly damaging 0.50
IGL01835:Adam23 APN 1 63543119 missense probably damaging 1.00
IGL01928:Adam23 APN 1 63557446 missense probably damaging 1.00
IGL02563:Adam23 APN 1 63567977 splice site probably benign
IGL02981:Adam23 APN 1 63570953 missense probably damaging 0.99
IGL03037:Adam23 APN 1 63571017 missense possibly damaging 0.63
IGL03176:Adam23 APN 1 63563416 missense probably damaging 1.00
IGL02991:Adam23 UTSW 1 63547819 critical splice donor site probably null
R0057:Adam23 UTSW 1 63570919 missense probably damaging 1.00
R0057:Adam23 UTSW 1 63570919 missense probably damaging 1.00
R0125:Adam23 UTSW 1 63534356 missense probably benign 0.00
R0477:Adam23 UTSW 1 63557400 splice site probably benign
R0538:Adam23 UTSW 1 63567844 splice site probably benign
R0617:Adam23 UTSW 1 63543147 missense probably benign 0.06
R1506:Adam23 UTSW 1 63547814 missense probably benign 0.01
R1599:Adam23 UTSW 1 63570933 missense possibly damaging 0.65
R1755:Adam23 UTSW 1 63543170 missense probably damaging 1.00
R1813:Adam23 UTSW 1 63545572 missense probably benign 0.07
R1858:Adam23 UTSW 1 63557456 missense probably benign 0.12
R1896:Adam23 UTSW 1 63545572 missense probably benign 0.07
R1943:Adam23 UTSW 1 63477757 critical splice donor site probably null
R2147:Adam23 UTSW 1 63534362 splice site probably null
R2211:Adam23 UTSW 1 63573129 intron probably benign
R2233:Adam23 UTSW 1 63545512 missense probably benign
R2249:Adam23 UTSW 1 63535176 nonsense probably null
R2363:Adam23 UTSW 1 63557491 splice site probably null
R3800:Adam23 UTSW 1 63551774 nonsense probably null
R3975:Adam23 UTSW 1 63547729 nonsense probably null
R4066:Adam23 UTSW 1 63563425 missense probably damaging 1.00
R4382:Adam23 UTSW 1 63566628 missense probably damaging 1.00
R4383:Adam23 UTSW 1 63566628 missense probably damaging 1.00
R4384:Adam23 UTSW 1 63566628 missense probably damaging 1.00
R4385:Adam23 UTSW 1 63566628 missense probably damaging 1.00
R5385:Adam23 UTSW 1 63551811 missense possibly damaging 0.74
R5435:Adam23 UTSW 1 63546453 missense possibly damaging 0.73
R6465:Adam23 UTSW 1 63566668 missense probably damaging 1.00
R6490:Adam23 UTSW 1 63557454 missense probably damaging 1.00
R6967:Adam23 UTSW 1 63563336 intron probably null
R7139:Adam23 UTSW 1 63545577 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCATGTGAAAACTTCCTGTTC -3'
(R):5'- TGATTAAACCACGGTGGCATGG -3'

Sequencing Primer
(F):5'- ACTTCCTGTTCTGAAAGATGCTTG -3'
(R):5'- CGGTGGCATGGAAATAAAGTATTCTC -3'
Posted On2015-04-30