Incidental Mutation 'R3974:Olfr1049'
ID312508
Institutional Source Beutler Lab
Gene Symbol Olfr1049
Ensembl Gene ENSMUSG00000075194
Gene Nameolfactory receptor 1049
SynonymsGA_x6K02T2Q125-47735396-47734470, MOR187-1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R3974 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location86254357-86258328 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 86255591 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 34 (I34N)
Ref Sequence ENSEMBL: ENSMUSP00000149360 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099899] [ENSMUST00000216185]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099899
AA Change: I34N

PolyPhen 2 Score 0.878 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000097483
Gene: ENSMUSG00000075194
AA Change: I34N

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 4.9e-54 PFAM
Pfam:7tm_1 41 290 5.6e-18 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000216185
AA Change: I34N

PolyPhen 2 Score 0.878 (Sensitivity: 0.82; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510039O18Rik T C 4: 147,945,031 I486T probably damaging Het
Abca8a A T 11: 110,083,502 M202K probably damaging Het
Abhd4 T A 14: 54,262,960 I117N probably damaging Het
Adam23 T A 1: 63,547,729 Y416* probably null Het
Cenpe A G 3: 135,235,225 probably null Het
Cenph A G 13: 100,763,567 V151A probably damaging Het
Cfap54 A G 10: 92,839,471 S2863P possibly damaging Het
Clca1 A T 3: 145,032,639 V36D probably damaging Het
Cnbd1 G A 4: 18,887,693 R274C probably benign Het
Crot T C 5: 8,977,541 T264A probably benign Het
Dll4 A G 2: 119,334,092 D664G probably damaging Het
Ehbp1 C T 11: 22,137,867 A406T probably benign Het
Far2 T A 6: 148,150,754 I177N probably damaging Het
Flt4 T G 11: 49,636,740 V910G probably damaging Het
Fmod A G 1: 134,040,758 R179G probably benign Het
Gdf2 T A 14: 33,944,834 V171D probably damaging Het
Gm884 A T 11: 103,619,101 probably benign Het
Gpx6 C A 13: 21,317,658 S150Y probably damaging Het
Grik2 A T 10: 49,422,654 Y37N probably damaging Het
Grn T C 11: 102,436,339 V559A probably damaging Het
Muc2 T A 7: 141,746,804 probably benign Het
Myo5b T C 18: 74,634,481 Y287H probably damaging Het
Nbeal2 T C 9: 110,633,846 T1350A probably damaging Het
Nfkbiz T C 16: 55,818,436 I220M probably benign Het
Nt5dc2 T C 14: 31,138,875 S439P probably damaging Het
Olfr598 T G 7: 103,329,078 D197E probably damaging Het
Omg T A 11: 79,502,398 E211D probably benign Het
Pcdhb4 A G 18: 37,308,848 T404A possibly damaging Het
Plcl1 T A 1: 55,698,215 M905K probably benign Het
Plod2 G T 9: 92,598,619 G422* probably null Het
Ppp1r12a T C 10: 108,253,480 V660A probably benign Het
Prdm6 T C 18: 53,540,206 I186T possibly damaging Het
Ptprq T G 10: 107,712,062 K158N possibly damaging Het
Rimbp2 A G 5: 128,797,798 V243A probably damaging Het
Rp1l1 T A 14: 64,030,309 Y1115N probably damaging Het
Rtn4 C T 11: 29,707,505 T553I probably damaging Het
Scrn3 T C 2: 73,335,777 S385P possibly damaging Het
Serpina1f C A 12: 103,693,571 G151* probably null Het
Sis T C 3: 72,943,635 T577A probably damaging Het
Slco1a1 A T 6: 141,909,093 S611T probably benign Het
Smad4 G T 18: 73,677,736 T59K possibly damaging Het
Syne1 T C 10: 5,043,630 D8370G probably benign Het
Tigd4 G A 3: 84,595,278 A501T possibly damaging Het
Tjp1 A T 7: 65,297,639 C1724* probably null Het
Tmem107 G T 11: 69,071,475 probably null Het
Tsc22d1 T C 14: 76,418,609 S761P probably damaging Het
Tyw5 A T 1: 57,391,528 D165E probably damaging Het
U2af2 T A 7: 5,069,439 probably null Het
Ube3b T A 5: 114,412,430 D839E probably benign Het
Ush2a A G 1: 188,381,501 D639G probably benign Het
Veph1 A T 3: 66,158,227 M473K probably benign Het
Vmn2r72 A T 7: 85,749,809 N445K probably damaging Het
Vps37d T C 5: 135,076,539 M77V probably null Het
Other mutations in Olfr1049
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01659:Olfr1049 APN 2 86255185 nonsense probably null
IGL03371:Olfr1049 APN 2 86255591 missense possibly damaging 0.88
IGL03378:Olfr1049 APN 2 86255019 missense possibly damaging 0.91
R1529:Olfr1049 UTSW 2 86255241 missense probably damaging 1.00
R1761:Olfr1049 UTSW 2 86255039 missense probably damaging 1.00
R1951:Olfr1049 UTSW 2 86255096 missense probably benign 0.01
R3499:Olfr1049 UTSW 2 86254841 missense possibly damaging 0.91
R4094:Olfr1049 UTSW 2 86255330 missense probably damaging 1.00
R4191:Olfr1049 UTSW 2 86255322 missense probably benign 0.03
R4659:Olfr1049 UTSW 2 86255013 nonsense probably null
R6431:Olfr1049 UTSW 2 86255358 missense probably benign 0.01
R7006:Olfr1049 UTSW 2 86255228 missense probably benign 0.01
R7090:Olfr1049 UTSW 2 86255076 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGAATGAAGCATGCCATTTGTG -3'
(R):5'- CTGTGACTAGTACGAAGTTTATATGGC -3'

Sequencing Primer
(F):5'- TGGCACAAGCATAATAGGTGATGTTG -3'
(R):5'- GTACGAAGTTTATATGGCAATGAAAG -3'
Posted On2015-04-30